Sample ID: VE25-1434_COI
Reference database: BLAST
Report generated from the Taxonomic Identification Nextflow workflow
This report describes the results of a taxonomic identification analysis for the sample
VE25-1434_COI
.
The analysis compares the sample's DNA sequence against a reference database of sequences with known taxonomy.
The results include the best matches from the database, which are referred to as "Candidates". To provide rigour, the report also includes an analysis of supporting publications (a measure of the integrity of candidate hit sequences), and database coverage of the different taxa that are of interest to the report.
Facility | QCIF |
Analyst | Magdalena Antczak |
Analysis start | 2025-07-01 02:19:05 |
Analysis end | 2025-07-01 05:12:47 |
Wall time |
2:53:42
hours
|
Dohrniphora cornuta
Preliminary morphology ID Phoridae confirmed? | True |
Outcome:
The preliminary identification is supported by the molecular data.
Reasoning: Identified species is consistent with preliminary ID. |
This Preliminary Morphology ID has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error).
For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Reference database:
BLAST Core Nt
Coverage of Phoridae | |
Coverage of species in genus Phoridae | |
Coverage of species in genus Phoridae in country of origin India |
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
There are 107,626 sequence records in the reference database for Phoridae that have been annotated with the given locus COI. It is possible that more records exist for this taxon which were not correctly annotated with this locus.
Global occurrence records for Phoridae.
Note that the occurrence data are not exhaustive, since the data fetched are limited to 5000 occurrence records.
It is therefore possible for this species to occur in regions not shown on the map.
Flag 5.2NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
Flag 5.3NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
Taxa of interest detected? | False |
Outcome:
None of the taxa of interest matched the candidates species.
Reasoning: Taxon of interest NOT detected in candidate species.
Outcome:
The reference data supports this taxon well.
Reasoning: The given locus for this taxon is well represented in reference database (>5 entries).
Outcome:
The reference data offers some support for species in this genus.
Reasoning: 10-90% of related taxa have reference sequence(s) at the given locus. |
Sample ID | VE25-1434_COI |
Locus | COI |
Preliminary ID | Phoridae |
Taxa of interest |
Megaselia scalaris |
Country | India |
Host | Fish meal |
Query DNA sequence |
>VE25-1434_COI AACATTATATTTTATTTTTGGTGCATGAGCAGGAATAGTAGGAACTTCATTAAGTATTAT AATCCGTGCTGAACTAGGTCACCCTGGTGCCTTAATTGGTGATGATCAAATTTATAATNG TAATTGTTACTGCACATGCTTTTATTATAATTTTCTTTATAGTAATACCTATTATAATAG GAGGATTTGGTAATTGACTTGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTC GAATAAATAATATAAGATTTTGACTTCTTCCTCCTTCTTTAACTTTACTTTTAGCAAGTA GTATAGTAGAAAATGGAGCTGGTACAGGATGAACTGTTTATCCACCTCTCTCTGCTAATA TTGCCCACAGTGGAAGTTCTGTCGATTTAGCAATTTTTTCTCTTCATCTAGCTGGTATTT CTTCAATTTTAGGAGCTGTAAATTTTATTACTACTATTATTAATATACGATCTACAGGAA TTACCTTTGACCGAATGCCTCTATTTGTCTGATCAGTAGGTATTACTGCTTTACTATWCA TTACCAGTTTTAGCAGGTGCAATTACTATA
db_type
|
blast_core_nt
|
metadata
|
/mnt/data/tests-wf-2//input/blast_core_nt/all_20250529_metadata.csv
|
outdir
|
/mnt/data/tests-wf-2//results/blast_core_nt/all_20250529/v100_20250701
|
sequences
|
/mnt/data/tests-wf-2//input/blast_core_nt/all_20250529_query.fasta
|
bold_skip_orientation
|
0
|
max_candidates_for_analysis
|
3
|
median_identity_warning_factor
|
0.95
|
min_identity
|
0.935
|
min_identity_strict
|
0.985
|
min_nt
|
300
|
min_q_coverage
|
0.85
|
phylogeny_min_hit_identity
|
0.95
|
phylogeny_min_hit_sequences
|
10
|
allowed_loci_file
|
/home/ubuntu/nextflow-pipeline/daff-taxassignwf/scripts/config/loci.json
|
db_cov_country_missing_a
|
1
|
db_cov_min_a
|
5
|
db_cov_min_b
|
1
|
db_cov_related_min_a
|
90
|
db_cov_related_min_b
|
10
|
db_coverage_toi_limit
|
10
|
gbif_accepted_status
|
accepted,doubtful
|
gbif_limit_records
|
500
|
gbif_max_occurrence_records
|
5000
|
min_source_count
|
5
|
blast_database_name_for_report
|
BLAST Core Nt
|
blast_max_target_seqs_for_report
|
2000
|
report_debug
|
0
|
email
|
None
|
logging_debug
|
0
|
accessions_filename
|
accessions.txt
|
blast_xml_filename
|
blast_result.xml
|
hits_fasta_filename
|
all_hits.fasta
|
hits_json_filename
|
all_hits.json
|
boxplot_img_filename
|
candidates_identity_boxplot.png
|
candidates_csv_filename
|
candidates.csv
|
candidates_fasta_filename
|
candidates.fasta
|
candidates_phylogeny_fasta_filename
|
candidates_phylogeny.fasta
|
candidates_json_filename
|
candidates.json
|
candidates_sources_json_filename
|
candidates_sources.json
|
independent_sources_json_filename
|
aggregated_sources.json
|
bold_taxonomy_json
|
bold_taxonomy.json
|
taxonomy_filename
|
taxonomy.csv
|
candidates_msa_filename
|
candidates_phylogeny.msa
|
tree_nwk_filename
|
candidates_phylogeny.nwk
|
email_on_fail
|
None
|
plaintext_email
|
False
|
monochrome_logs
|
False
|
help
|
False
|
help_full
|
False
|
show_hidden
|
False
|
version
|
False
|
pipelines_testdata_base_path
|
https://raw.githubusercontent.com/nf-core/test-datasets/
|
trace_report_suffix
|
2025-07-01_02-19-03
|
config_profile_name
|
None
|
config_profile_description
|
None
|
custom_config_version
|
master
|
blastdb
|
/home/ubuntu/blastdbs/20250329/core_nt
|
taxdb
|
/home/ubuntu/.taxonkit/
|
analyst_name
|
Magdalena Antczak
|
facility_name
|
QCIF
|
ncbi_api_key
|
d2c2e49b459493d627948bc7d5a07fca5c08
|
ncbi_user_email
|
magdalena.antczak@qcif.edu.au
|
custom_config_base
|
https://raw.githubusercontent.com/nf-core/configs/master
|
config_profile_contact
|
None
|
config_profile_url
|
None
|
validate_params
|
True
|
blast
|
2.16.0+
|
fastme
|
2.1.6.3
|
mafft
|
7.52
|
qcif/taxaplus
|
v1.0.0
|
Nextflow
|
24.10.6
|
ⓘ BLAST hits must meet ONE of these criteria to be considered for candidate screening:
Minimum alignment length ⓘ |
300bp
|
Minimum query coverage ⓘ |
85.0%
|
ⓘ BLAST hits have been classified as follows:
Classification | Alignment identity ⓘ | Number of hits ⓘ | Number of species ⓘ |
---|---|---|---|
STRONG MATCH | ≥ 98.5% | 1 | 1 |
MODERATE MATCH | ≥ 93.5% | 6 | 1 |
NO MATCH | < 93.5% | 493 | 62 |
Species | No. hits ⓘ | Top identity ⓘ | Median identity ⓘ | Top E-value ⓘ | Database coverage ⓘ | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|
Dohrniphora cornuta | 1 | 99.6% | 97.8% | 0.0 |
Database coverage of Candidate Dohrniphora cornutaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Reference database:
Database coverage of Dohrniphora cornuta
Flag 5.1A:
The reference data supports this taxon well
16 records
There are 16 sequence records in the reference database for Dohrniphora cornuta that have been annotated with the given locus COI. It is possible that more records exist for this taxon which were not correctly annotated with this locus.
Global occurrence records for Dohrniphora cornuta.
Database coverage of species in genus Dohrniphora
Flag 5.2B:
The reference data offers some support for species in this genus
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COI Database coverage of species in genus Dohrniphora that occur in country of origin India
Flag 5.3C:
It's unlikely that the true taxonomic identity is another species in this genus, because no others have been recorded in the sample's country of origin
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COI |
This table shows all results that were returned by the BLAST search.
Each row represents a reference sequence that matched the query
sequence.
Use CTRL+F
to search the table, and click table headers
to sort by column. Click on a row to show the corresponding BLAST
alignment and taxonomy information in the bottom panes.
Rank ⓘ | Accession ⓘ | Hit subject ⓘ | Align length ⓘ | Query coverage ⓘ | Bitscore ⓘ | E-value ⓘ | Identity ⓘ |
---|---|---|---|---|---|---|---|
1 | KR666968 | Dohrniphora cornuta voucher BIOUG00942-F05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 535 | 93.9% | 1043.16 | 0.00e+00 | 99.6% |
2 | MG947378 | Dohrniphora cornuta voucher 7508_013 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 570 | 100.0% | 1049.11 | 0.00e+00 | 97.9% |
3 | HQ984503 | Dohrniphora cornuta voucher BIOUG570 |
100.0% |
1045.14 |
0.00e+00 |
97.9% |
|
4 | KR659695 | Dohrniphora cornuta voucher BIOUG00938-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 570 | 100.0% | 1037.22 | 0.00e+00 | 97.8% |
5 | MG293276 | Dohrniphora cornuta voucher BIOUG31051-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 560 | 98.2% | 1005.5 | 0.00e+00 | 97.4% |
6 | JQ941749 | Dohrniphora cornuta isolate 49 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 535 | 93.9% | 892.51 | 0.00e+00 | 96.1% |
7 | MN832849 | Dohrniphora cornuta mitochondrion, complete genome | 535 | 93.9% | 892.51 | 0.00e+00 | 96.1% |
8 | OQ532023 | Phoridae sp. voucher ZRCBDP0375063 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 536 | 94.0% | 743.841 | 0.00e+00 | 92.5% |
9 | OQ530590 | Phoridae sp. voucher ZRCBDP0365007 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 535 | 93.9% | 741.858 | 0.00e+00 | 92.5% |
10 | OQ530389 | Phoridae sp. voucher ZRCBDP0364768 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 536 | 94.0% | 735.912 | 0.00e+00 | 92.4% |
11 | OQ530781 | Phoridae sp. voucher ZRCBDP0365243 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 536 | 94.0% | 735.912 | 0.00e+00 | 92.4% |
12 | OQ532499 | Phoridae sp. voucher ZRCBDP0375585 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 535 | 93.9% | 733.929 | 0.00e+00 | 92.3% |
13 | OQ527298 | Phoridae sp. voucher ZRCBDP0360646 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 535 | 93.9% | 733.929 | 0.00e+00 | 92.3% |
14 | MN520900 | Dohrniphora sp. SAEVG Morph0080 cytochrome oxidase subunit I (CO1) gene, partial cds; mitochondrial | 504 | 88.4% | 672.479 | 0.00e+00 | 91.9% |
15 | OQ530222 | Phoridae sp. voucher ZRCBDP0364586 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 526 | 92.3% | 676.444 | 0.00e+00 | 91.3% |
16 | OQ530431 | Phoridae sp. voucher ZRCBDP0364825 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 526 | 92.3% | 676.444 | 0.00e+00 | 91.3% |
17 | OQ530428 | Phoridae sp. voucher ZRCBDP0364822 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 526 | 92.3% | 668.515 | 0.00e+00 | 91.1% |
18 | MN403778 | Phoridae sp. isolate UGC0005429 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 531 | 93.2% | 654.639 | 0.00e+00 | 90.6% |
19 | MN404130 | Phoridae sp. isolate UGC0006441 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 531 | 93.2% | 654.639 | 0.00e+00 | 90.6% |
20 | OQ532738 | Phoridae sp. voucher ZRCBDP364248 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 526 | 92.3% | 644.728 | 3.84e-180 | 90.5% |
21 | JN298710 | Diptera sp. BOLD:AAU5601 voucher gvc14959-1L cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 533 | 93.5% | 650.674 | 0.00e+00 | 90.4% |
22 | MN407575 | Phoridae sp. isolate UGC0005413 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 531 | 93.2% | 648.692 | 0.00e+00 | 90.4% |
23 | MN404062 | Phoridae sp. isolate UGC0004728 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 531 | 93.2% | 648.692 | 0.00e+00 | 90.4% |
24 | MG290834 | Megaselia rufipes voucher BIOUG27635-D02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 642.745 | 1.52e-179 | 90.4% |
25 | MN409852 | Phoridae sp. isolate UGC0003246 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 636.798 | 9.35e-178 | 90.4% |
26 | MN407428 | Phoridae sp. isolate UGC0006415 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 636.798 | 9.35e-178 | 90.4% |
27 | MN403995 | Phoridae sp. isolate UGC0009773 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 636.798 | 9.35e-178 | 90.4% |
28 | MN403516 | Phoridae sp. isolate UGC0011929 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 636.798 | 9.35e-178 | 90.4% |
29 | MN406576 | Phoridae sp. isolate UGC0002271 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 636.798 | 9.35e-178 | 90.4% |
30 | MN407279 | Phoridae sp. isolate UGC0012168 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 636.798 | 9.35e-178 | 90.4% |
31 | MN404305 | Phoridae sp. isolate UGC0011652 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 636.798 | 9.35e-178 | 90.4% |
32 | MN409697 | Phoridae sp. isolate UGC0002241 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 636.798 | 9.35e-178 | 90.4% |
33 | MN405774 | Phoridae sp. isolate UGC0003384 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 636.798 | 9.35e-178 | 90.4% |
34 | MN405262 | Phoridae sp. isolate UGC0012385 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 636.798 | 9.35e-178 | 90.4% |
35 | MN404154 | Phoridae sp. isolate UGC0012139 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 636.798 | 9.35e-178 | 90.4% |
36 | MN405370 | Phoridae sp. isolate UGC0002254 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 636.798 | 9.35e-178 | 90.4% |
37 | MN404155 | Phoridae sp. isolate UGC0011117 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 636.798 | 9.35e-178 | 90.4% |
38 | MN404482 | Phoridae sp. isolate UGC0002236 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 636.798 | 9.35e-178 | 90.4% |
39 | MF867663 | Megaselia nigriceps voucher BIOUG21044-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 89.5% | 620.94 | 5.56e-173 | 90.4% |
40 | KT702116 | Phoridae sp. BOLD:AAM9378 voucher BIOUG22634-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 89.5% | 620.94 | 5.56e-173 | 90.4% |
41 | KT100231 | Megaselia sp. BOLD-2016 voucher BIOUG02891-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 89.5% | 620.94 | 5.56e-173 | 90.4% |
42 | KT111453 | Megaselia sp. BOLD-2016 voucher BIOUG01307-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 636.798 | 9.35e-178 | 90.3% |
43 | MN408458 | Phoridae sp. isolate UGC0002106 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 634.816 | 3.70e-177 | 90.3% |
44 | MN408962 | Phoridae sp. isolate UGC0012916 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 634.816 | 3.70e-177 | 90.3% |
45 | MF863572 | Megaselia nigriceps voucher BIOUG21860-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 504 | 88.4% | 609.047 | 2.11e-169 | 90.3% |
46 | MG297140 | Megaselia rufipes voucher BIOUG30415-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 636.798 | 9.35e-178 | 90.2% |
47 | KR682983 | Megaselia rufipes voucher BIOUG01756-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 636.798 | 9.35e-178 | 90.2% |
48 | KR678660 | Megaselia rufipes voucher BIOUG01752-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 636.798 | 9.35e-178 | 90.2% |
49 | MG296924 | Megaselia rufipes voucher BIOUG27637-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 634.816 | 3.70e-177 | 90.2% |
50 | MN407450 | Phoridae sp. isolate UGC0005080 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 630.852 | 5.77e-176 | 90.2% |
51 | MN404682 | Phoridae sp. isolate UGC0012412 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 630.852 | 5.77e-176 | 90.2% |
52 | MN406060 | Phoridae sp. isolate UGC0005352 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 628.869 | 2.28e-175 | 90.2% |
53 | KR644500 | Megaselia sp. BOLD-2016 voucher BIOUG02514-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 89.5% | 614.994 | 3.43e-171 | 90.2% |
54 | KT108478 | Megaselia sp. BOLD-2016 voucher BIOUG01307-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 89.5% | 613.011 | 1.35e-170 | 90.2% |
55 | KR756045 | Megaselia sp. BOLD-2016 voucher 10PHMAL-2819 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 89.5% | 613.011 | 1.35e-170 | 90.2% |
56 | MN409868 | Phoridae sp. isolate UGC0002123 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 630.852 | 5.77e-176 | 90.1% |
57 | KR637343 | Phoridae sp. BOLD-2016 voucher BIOUG02724-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 628.869 | 2.28e-175 | 90.1% |
58 | KR740358 | Megaselia sp. BOLD-2016 voucher 10PHMAL-1232 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 628.869 | 2.28e-175 | 90.1% |
59 | KR745674 | Megaselia sp. BOLD-2016 voucher BIOUG01298-F05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 628.869 | 2.28e-175 | 90.1% |
60 | KT702626 | Phoridae sp. BOLD:AAM9378 voucher BIOUG22835-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 628.869 | 2.28e-175 | 90.1% |
61 | MN409850 | Phoridae sp. isolate UGC0003245 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 628.869 | 2.28e-175 | 90.1% |
62 | OQ532605 | Phoridae sp. voucher ZRCBDP0375694 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 526 | 92.3% | 628.869 | 2.28e-175 | 90.1% |
63 | MF862875 | Megaselia nigriceps voucher BIOUG21845-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 628.869 | 2.28e-175 | 90.1% |
64 | MG102796 | Megaselia nigriceps voucher BIOUG01423-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 628.869 | 2.28e-175 | 90.1% |
65 | KT703952 | Phoridae sp. BOLD:AAM9378 voucher BIOUG22634-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 628.869 | 2.28e-175 | 90.1% |
66 | KT704583 | Phoridae sp. BOLD:AAM9378 voucher BIOUG22634-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 628.869 | 2.28e-175 | 90.1% |
67 | MN407798 | Phoridae sp. isolate UGC0010250 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 628.869 | 2.28e-175 | 90.1% |
68 | HQ982263 | Megaselia nigriceps voucher BIOUG526 |
92.3% |
628.869 |
2.28e-175 |
90.1% |
|
69 | KR665553 | Megaselia sp. BOLD-2016 voucher BIOUG07773-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 628.869 | 2.28e-175 | 90.1% |
70 | KR646358 | Megaselia sp. BOLD-2016 voucher BIOUG02628-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 628.869 | 2.28e-175 | 90.1% |
71 | MN404930 | Phoridae sp. isolate UGC0012558 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 628.869 | 2.28e-175 | 90.1% |
72 | MN404454 | Phoridae sp. isolate UGC0012846 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 626.887 | 9.01e-175 | 90.1% |
73 | MN408050 | Phoridae sp. isolate UGC0012855 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 626.887 | 9.01e-175 | 90.1% |
74 | MN407339 | Phoridae sp. isolate UGC0012835 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 626.887 | 9.01e-175 | 90.1% |
75 | MN406924 | Phoridae sp. isolate UGC0004794 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 620.94 | 5.56e-173 | 90.1% |
76 | MN403623 | Phoridae sp. isolate UGC0004782 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 620.94 | 5.56e-173 | 90.1% |
77 | MN409854 | Phoridae sp. isolate UGC0003241 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 620.94 | 5.56e-173 | 90.1% |
78 | MN409527 | Phoridae sp. isolate UGC0010938 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 620.94 | 5.56e-173 | 90.1% |
79 | MF855192 | Diplonevra nitidula voucher BIOUG21367-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 513 | 90.0% | 611.029 | 5.35e-170 | 90.1% |
80 | KJ085265 | Megaselia sp. BOLD:AAG3274 voucher BIOUG03245-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 628.869 | 2.28e-175 | 90.0% |
81 | KJ085595 | Megaselia sp. BOLD:AAG3274 voucher BIOUG03248-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 628.869 | 2.28e-175 | 90.0% |
82 | KJ167009 | Megaselia sp. BOLD:AAG3274 voucher BIOUG03369-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 628.869 | 2.28e-175 | 90.0% |
83 | HM417219 | Megaselia hardingorum voucher BIOUG530 |
93.0% |
628.869 |
2.28e-175 |
90.0% |
|
84 | KJ091604 | Megaselia sp. BOLD:AAG3274 voucher BIOUG03246-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 628.869 | 2.28e-175 | 90.0% |
85 | KJ084091 | Megaselia sp. BOLD:AAG3274 voucher BIOUG03369-E08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 628.869 | 2.28e-175 | 90.0% |
86 | KR679085 | Megaselia rufipes voucher BIOUG01672-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 628.869 | 2.28e-175 | 90.0% |
87 | KJ086321 | Megaselia sp. BOLD:AAG3274 voucher BIOUG03261-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 628.869 | 2.28e-175 | 90.0% |
88 | KR677841 | Megaselia rufipes voucher BIOUG01670-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 628.869 | 2.28e-175 | 90.0% |
89 | MG102877 | Megaselia rufipes voucher BIOUG27398-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 626.887 | 9.01e-175 | 90.0% |
90 | MG296376 | Megaselia rufipes voucher BIOUG30431-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 626.887 | 9.01e-175 | 90.0% |
91 | MG102653 | Megaselia rufipes voucher BIOUG25761-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 626.887 | 9.01e-175 | 90.0% |
92 | MG110429 | Megaselia rufipes voucher BIOUG27526-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 626.887 | 9.01e-175 | 90.0% |
93 | MF865818 | Megaselia rufipes voucher BIOUG21467-E08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 626.887 | 9.01e-175 | 90.0% |
94 | KR764070 | Diplonevra nitidula voucher BIOUG16051-E03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 620.94 | 5.56e-173 | 90.0% |
95 | KT095085 | Megaselia rufipes voucher BIOUG09307-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 521 | 91.4% | 618.958 | 2.20e-172 | 90.0% |
96 | KR757112 | Megaselia rufipes voucher BIOUG05716-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 520 | 91.2% | 616.976 | 8.67e-172 | 90.0% |
97 | KT700267 | Phoridae sp. BOLD:AAM9378 voucher BIOUG22847-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 520 | 91.2% | 616.976 | 8.67e-172 | 90.0% |
98 | KT705118 | Phoridae sp. BOLD:AAM9378 voucher BIOUG22842-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 520 | 91.2% | 616.976 | 8.67e-172 | 90.0% |
99 | MG108157 | Diplonevra nitidula voucher BIOUG08693-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 511 | 89.6% | 607.065 | 8.35e-169 | 90.0% |
100 | KR751078 | Megaselia sp. BOLD-2016 voucher BIOUG01580-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 89.5% | 605.082 | 3.30e-168 | 90.0% |
101 | JF871662 | Phoridae sp. BOLD:AAM9348 voucher BIOUG533 |
93.5% |
626.887 |
9.01e-175 |
89.9% |
|
102 | OR929511 | Megaselia flava voucher SMNS_1199903 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 533 | 93.5% | 626.887 | 9.01e-175 | 89.9% |
103 | KJ092156 | Phoridae sp. BOLD:AAM9378 voucher BIOUG03341-D09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 620.94 | 5.56e-173 | 89.9% |
104 | OQ528033 | Phoridae sp. voucher ZRCBDP0361597 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 526 | 92.3% | 620.94 | 5.56e-173 | 89.9% |
105 | KR429305 | Megaselia sp. BOLD-2016 voucher BIOUG04314-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 620.94 | 5.56e-173 | 89.9% |
106 | KT100851 | Diplonevra nitidula voucher BIOUG01360-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 620.94 | 5.56e-173 | 89.9% |
107 | KR643382 | Megaselia sp. BOLD-2016 voucher BIOUG02665-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 620.94 | 5.56e-173 | 89.9% |
108 | KR637687 | Phoridae sp. BOLD-2016 voucher BIOUG02669-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 620.94 | 5.56e-173 | 89.9% |
109 | HQ581779 | Megaselia nigriceps voucher BIOUG526 |
92.3% |
620.94 |
5.56e-173 |
89.9% |
|
110 | OR924481 | Diplonevra nitidula voucher SMNS_1206456 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 620.94 | 5.56e-173 | 89.9% |
111 | MG105857 | Megaselia nigriceps voucher BIOUG23941-H01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 620.94 | 5.56e-173 | 89.9% |
112 | MN408455 | Phoridae sp. isolate UGC0002103 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 620.94 | 5.56e-173 | 89.9% |
113 | MN407049 | Phoridae sp. isolate UGC0013393 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 620.94 | 5.56e-173 | 89.9% |
114 | KR438019 | Megaselia sp. BOLD-2016 voucher BIOUG04313-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 620.94 | 5.56e-173 | 89.9% |
115 | KT703344 | Phoridae sp. BOLD:AAM9378 voucher BIOUG22634-D09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 620.94 | 5.56e-173 | 89.9% |
116 | MN409350 | Phoridae sp. isolate UGC0013322 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 620.94 | 5.56e-173 | 89.9% |
117 | KR747476 | Megaselia sp. BOLD-2016 voucher 10PHMAL-1325 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 620.94 | 5.56e-173 | 89.9% |
118 | MN407035 | Phoridae sp. isolate UGC0012624 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 620.94 | 5.56e-173 | 89.9% |
119 | KJ163851 | Phoridae sp. BOLD:AAM9378 voucher BIOUG03448-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 620.94 | 5.56e-173 | 89.9% |
120 | MF862353 | Megaselia nigriceps voucher BIOUG21008-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 620.94 | 5.56e-173 | 89.9% |
121 | MN409333 | Phoridae sp. isolate UGC0002160 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 618.958 | 2.20e-172 | 89.9% |
122 | MN408836 | Phoridae sp. isolate UGC0012564 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 618.958 | 2.20e-172 | 89.9% |
123 | MN407234 | Phoridae sp. isolate UGC0013187 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 618.958 | 2.20e-172 | 89.9% |
124 | MN405556 | Phoridae sp. isolate UGC0002146 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 618.958 | 2.20e-172 | 89.9% |
125 | MN409619 | Phoridae sp. isolate UGC0002143 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 618.958 | 2.20e-172 | 89.9% |
126 | MN408105 | Phoridae sp. isolate UGC0013066 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 616.976 | 8.67e-172 | 89.9% |
127 | MN404363 | Phoridae sp. isolate UGC0004793 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.9% |
128 | MN410201 | Phoridae sp. isolate UGC0004785 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.9% |
129 | MG108638 | Megaselia nigriceps voucher BIOUG23941-G04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 517 | 90.7% | 611.029 | 5.35e-170 | 89.9% |
130 | KT098245 | Diplonevra nitidula voucher BIOUG10426-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 517 | 90.7% | 611.029 | 5.35e-170 | 89.9% |
131 | KR652822 | Diplonevra nitidula voucher BIOUG02722-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 517 | 90.7% | 611.029 | 5.35e-170 | 89.9% |
132 | KT113349 | Megaselia sp. BOLD-2016 voucher BIOUG02907-G10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 517 | 90.7% | 611.029 | 5.35e-170 | 89.9% |
133 | MF861847 | Megaselia rufipes voucher BIOUG26464-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 517 | 90.7% | 611.029 | 5.35e-170 | 89.9% |
134 | KR638887 | Diplonevra nitidula voucher BIOUG02640-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 517 | 90.7% | 611.029 | 5.35e-170 | 89.9% |
135 | KT087777 | Diplonevra nitidula voucher BIOUG10420-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 517 | 90.7% | 611.029 | 5.35e-170 | 89.9% |
136 | KT086540 | Diplonevra nitidula voucher BIOUG11003-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 517 | 90.7% | 611.029 | 5.35e-170 | 89.9% |
137 | KT106395 | Megaselia sp. BOLD-2016 voucher BIOUG02868-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 517 | 90.7% | 611.029 | 5.35e-170 | 89.9% |
138 | KR432130 | Diplonevra nitidula voucher BIOUG04480-E10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 515 | 90.4% | 607.065 | 8.35e-169 | 89.9% |
139 | KR641417 | Megaselia rufipes voucher BIOUG02600-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 620.94 | 5.56e-173 | 89.8% |
140 | KY842168 | Phoridae sp. BIOUG02131-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 620.94 | 5.56e-173 | 89.8% |
141 | KY837331 | Phoridae sp. BIOUG02131-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 620.94 | 5.56e-173 | 89.8% |
142 | KR651910 | Megaselia rufipes voucher BIOUG02652-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 620.94 | 5.56e-173 | 89.8% |
143 | KR639801 | Phoridae sp. BOLD-2016 voucher BIOUG02596-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 620.94 | 5.56e-173 | 89.8% |
144 | MG294878 | Megaselia rufipes voucher BIOUG30431-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 620.94 | 5.56e-173 | 89.8% |
145 | KR647916 | Megaselia rufipes voucher BIOUG02597-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 620.94 | 5.56e-173 | 89.8% |
146 | KR642899 | Megaselia rufipes voucher BIOUG02599-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 620.94 | 5.56e-173 | 89.8% |
147 | KY844607 | Phoridae sp. BIOUG02132-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 620.94 | 5.56e-173 | 89.8% |
148 | KR639933 | Megaselia sp. BOLD-2016 voucher BIOUG02599-C12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 620.94 | 5.56e-173 | 89.8% |
149 | KR655094 | Megaselia rufipes voucher BIOUG09353-D09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 620.94 | 5.56e-173 | 89.8% |
150 | KR682416 | Megaselia rufipes voucher BIOUG01672-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 620.94 | 5.56e-173 | 89.8% |
151 | KR662704 | Megaselia rufipes voucher BIOUG09139-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 620.94 | 5.56e-173 | 89.8% |
152 | KP049684 | Phoridae sp. BOLD:AAP8722 voucher BIOUG04642-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 618.958 | 2.20e-172 | 89.8% |
153 | KT622638 | Megaselia rufipes voucher BIOUG21483-A02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 618.958 | 2.20e-172 | 89.8% |
154 | MF863309 | Megaselia rufipes voucher BIOUG21648-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 618.958 | 2.20e-172 | 89.8% |
155 | MN407448 | Phoridae sp. isolate UGC0004755 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 529 | 92.8% | 618.958 | 2.20e-172 | 89.8% |
156 | MF864881 | Megaselia sp. BIOUG26984-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 528 | 92.6% | 616.976 | 8.67e-172 | 89.8% |
157 | MN671753 | Megaselia shatesae voucher CHARS00215-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 527 | 92.5% | 614.994 | 3.43e-171 | 89.8% |
158 | KT111736 | Diplonevra nitidula voucher BIOUG02891-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
159 | KR773053 | Diplonevra nitidula voucher BIOUG08380-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
160 | MN682895 | Megaselia shatesae voucher CHARS00227-E12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.8% |
161 | KR768070 | Diplonevra nitidula voucher BIOUG16037-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
162 | KR763321 | Diplonevra nitidula voucher BIOUG16051-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
163 | KR758903 | Diplonevra nitidula voucher BIOUG08662-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
164 | KR758888 | Diplonevra nitidula voucher BIOUG08684-G10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
165 | KT704808 | Phoridae sp. BOLD:AAG3236 voucher BIOUG22721-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
166 | GU806506 | Diplonevra nitidula voucher BIOUG522 |
91.6% |
613.011 |
1.35e-170 |
89.8% |
|
167 | KR767527 | Diplonevra nitidula voucher BIOUG16090-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
168 | MG108077 | Diplonevra nitidula voucher BIOUG24730-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
169 | KT702809 | Phoridae sp. BOLD:AAG3236 voucher BIOUG22865-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
170 | MN672926 | Megaselia shatesae voucher CHARS00145-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.8% |
171 | MG293787 | Phorinae sp. BIOUG31124-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
172 | MN676919 | Megaselia shatesae voucher CHARS00239-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.8% |
173 | KT111909 | Diplonevra nitidula voucher BIOUG02874-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
174 | KT077973 | Diplonevra nitidula voucher BIOUG10495-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
175 | KR519134 | Diplonevra nitidula voucher BIOUG12661-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
176 | KR667507 | Diplonevra nitidula voucher BIOUG07710-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
177 | KT094493 | Diplonevra nitidula voucher BIOUG08713-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
178 | MG109460 | Diplonevra nitidula voucher BIOUG25588-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
179 | KT119243 | Diplonevra nitidula voucher BIOUG02905-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
180 | KR767290 | Diplonevra nitidula voucher BIOUG08495-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
181 | MN676109 | Megaselia shatesae voucher CHARS00229-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.8% |
182 | KR768081 | Diplonevra nitidula voucher BIOUG08380-D09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
183 | MG294999 | Phorinae sp. BIOUG31153-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
184 | HM412839 | Diplonevra nitidula voucher BIOUG522 |
91.6% |
613.011 |
1.35e-170 |
89.8% |
|
185 | KT100418 | Diplonevra nitidula voucher BIOUG02895-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
186 | KT095728 | Diplonevra nitidula voucher BIOUG12168-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
187 | KR521252 | Diplonevra nitidula voucher BIOUG13705-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
188 | KT115261 | Diplonevra nitidula voucher BIOUG02896-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
189 | KT093727 | Diplonevra nitidula voucher BIOUG12165-C12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 613.011 | 1.35e-170 | 89.8% |
190 | MN676082 | Megaselia shatesae voucher CHARS00146-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.8% |
191 | MG296563 | Megaselia rufipes voucher BIOUG27568-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 520 | 91.2% | 609.047 | 2.11e-169 | 89.8% |
192 | MF867576 | Megaselia nigriceps voucher BIOUG21178-E10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 520 | 91.2% | 609.047 | 2.11e-169 | 89.8% |
193 | MG107139 | Megaselia rufipes voucher BIOUG27399-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 520 | 91.2% | 609.047 | 2.11e-169 | 89.8% |
194 | KR644384 | Diplonevra nitidula voucher BIOUG02499-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 519 | 91.1% | 607.065 | 8.35e-169 | 89.8% |
195 | KR654224 | Diplonevra nitidula voucher BIOUG08937-H01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 518 | 90.9% | 605.082 | 3.30e-168 | 89.8% |
196 | KT084997 | Diplonevra nitidula voucher BIOUG11244-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 518 | 90.9% | 605.082 | 3.30e-168 | 89.8% |
197 | KR654355 | Diplonevra nitidula voucher BIOUG09133-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 518 | 90.9% | 605.082 | 3.30e-168 | 89.8% |
198 | KR665481 | Diplonevra nitidula voucher BIOUG10069-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 518 | 90.9% | 605.082 | 3.30e-168 | 89.8% |
199 | KR657282 | Diplonevra nitidula voucher BIOUG09135-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 518 | 90.9% | 605.082 | 3.30e-168 | 89.8% |
200 | KT092390 | Diplonevra nitidula voucher BIOUG11245-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 518 | 90.9% | 605.082 | 3.30e-168 | 89.8% |
201 | KT086600 | Diplonevra nitidula voucher BIOUG10549-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 518 | 90.9% | 605.082 | 3.30e-168 | 89.8% |
202 | KP044154 | Diplonevra nitidula voucher BIOUG06889-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 518 | 90.9% | 605.082 | 3.30e-168 | 89.8% |
203 | KY838916 | Phoridae sp. BIOUG04901-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 533 | 93.5% | 618.958 | 2.20e-172 | 89.7% |
204 | KY846810 | Phoridae sp. BIOUG04902-D02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 533 | 93.5% | 618.958 | 2.20e-172 | 89.7% |
205 | KY843331 | Phoridae sp. BIOUG04902-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 533 | 93.5% | 618.958 | 2.20e-172 | 89.7% |
206 | KR429261 | Megaselia sp. BOLD-2016 voucher BIOUG05824-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 533 | 93.5% | 618.958 | 2.20e-172 | 89.7% |
207 | KY830598 | Phoridae sp. BIOUG04901-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 533 | 93.5% | 618.958 | 2.20e-172 | 89.7% |
208 | KR681263 | Megaselia sp. BOLD-2016 voucher BIOUG07176-B07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 533 | 93.5% | 618.958 | 2.20e-172 | 89.7% |
209 | HQ582861 | Phoridae sp. BOLD:AAM9348 voucher BIOUG533 |
93.5% |
618.958 |
2.20e-172 |
89.7% |
|
210 | KY839018 | Phoridae sp. BIOUG04902-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 533 | 93.5% | 618.958 | 2.20e-172 | 89.7% |
211 | KR990760 | Megaselia sp. BOLD-2016 voucher BIOUG19332-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 532 | 93.3% | 616.976 | 8.67e-172 | 89.7% |
212 | KR988489 | Megaselia sp. BOLD-2016 voucher BIOUG19256-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 532 | 93.3% | 616.976 | 8.67e-172 | 89.7% |
213 | MN409993 | Phoridae sp. isolate UGC0013113 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 614.994 | 3.43e-171 | 89.7% |
214 | MF867568 | Megaselia nigriceps voucher BIOUG21008-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 614.994 | 3.43e-171 | 89.7% |
215 | KR743423 | Diplonevra nitidula voucher BIOUG10772-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
216 | KR637697 | Phoridae sp. BOLD-2016 voucher BIOUG02722-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
217 | KR639091 | Phoridae sp. BOLD-2016 voucher BIOUG02722-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
218 | KR638552 | Phoridae sp. BOLD-2016 voucher BIOUG02640-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
219 | MN403637 | Phoridae sp. isolate UGC0013177 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 613.011 | 1.35e-170 | 89.7% |
220 | KR772021 | Diplonevra nitidula voucher BIOUG16098-E10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
221 | KR646722 | Diplonevra nitidula voucher BIOUG02656-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
222 | KT076289 | Diplonevra nitidula voucher BIOUG09937-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
223 | KR761595 | Diplonevra nitidula voucher BIOUG16001-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
224 | KR756246 | Diplonevra nitidula voucher 10PHMAL-1194 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
225 | KR666997 | Diplonevra nitidula voucher BIOUG09139-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
226 | KR749576 | Diplonevra nitidula voucher BIOUG10726-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
227 | KR673233 | Diplonevra nitidula voucher BIOUG09003-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
228 | HM386323 | Diplonevra nitidula voucher BIOUG526 |
92.3% |
613.011 |
1.35e-170 |
89.7% |
|
229 | KT095099 | Diplonevra nitidula voucher BIOUG11146-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
230 | KJ085038 | Diplonevra nitidula voucher BIOUG03249-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
231 | KT089649 | Diplonevra nitidula voucher BIOUG11224-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
232 | KR633434 | Diplonevra nitidula voucher BIOUG02384-E10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
233 | KR756325 | Diplonevra nitidula voucher BIOUG10772-E12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
234 | KR672854 | Diplonevra nitidula voucher BIOUG08561-D01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
235 | KR655364 | Diplonevra nitidula voucher BIOUG10069-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
236 | KR640418 | Phoridae sp. BOLD-2016 voucher BIOUG02499-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
237 | KT112892 | Diplonevra nitidula voucher BIOUG02929-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
238 | KR639911 | Phoridae sp. BOLD-2016 voucher BIOUG02640-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
239 | KR740903 | Diplonevra nitidula voucher 10PHMAL-1247 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
240 | KR646266 | Diplonevra nitidula voucher BIOUG02499-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
241 | KT095270 | Diplonevra nitidula voucher BIOUG11085-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
242 | KT075529 | Diplonevra nitidula voucher BIOUG10709-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
243 | MG102558 | Phorinae sp. BIOUG32188-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
244 | KT087001 | Diplonevra nitidula voucher BIOUG11018-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
245 | KR425977 | Diplonevra nitidula voucher BIOUG04314-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
246 | HQ577725 | Diplonevra nitidula voucher BIOUG526 |
92.3% |
613.011 |
1.35e-170 |
89.7% |
|
247 | KR671340 | Diplonevra nitidula voucher BIOUG09140-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
248 | HQ981766 | Diplonevra nitidula voucher BIOUG526 |
92.3% |
613.011 |
1.35e-170 |
89.7% |
|
249 | KR640581 | Phoridae sp. BOLD-2016 voucher BIOUG02630-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
250 | KT093370 | Diplonevra nitidula voucher BIOUG10385-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
251 | KT081707 | Diplonevra nitidula voucher BIOUG11088-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
252 | KR655682 | Diplonevra nitidula voucher BIOUG01604-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
253 | MG109992 | Megaselia nigriceps voucher BIOUG25523-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
254 | KT082282 | Diplonevra nitidula voucher BIOUG09996-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
255 | JN302057 | Diplonevra nitidula voucher BIOUG526 |
92.3% |
613.011 |
1.35e-170 |
89.7% |
|
256 | KR649655 | Diplonevra nitidula voucher BIOUG07126-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
257 | KT080659 | Diplonevra nitidula voucher BIOUG10783-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
258 | KT096188 | Diplonevra nitidula voucher BIOUG11223-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
259 | KR441354 | Diplonevra nitidula voucher BIOUG06079-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
260 | KR641217 | Diplonevra nitidula voucher BIOUG02656-C12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
261 | KP043490 | Diplonevra nitidula voucher BIOUG06890-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
262 | KR653611 | Diplonevra nitidula voucher BIOUG09930-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
263 | KJ208317 | Diplonevra nitidula voucher BIOUG03908-H07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
264 | KP039191 | Diplonevra nitidula voucher BIOUG07024-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
265 | KR431128 | Diplonevra nitidula voucher BIOUG06074-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
266 | KR686736 | Diplonevra nitidula voucher BIOUG01796-F05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
267 | MG294101 | Phorinae sp. BIOUG32604-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
268 | KT081983 | Diplonevra nitidula voucher BIOUG10420-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
269 | KR761563 | Diplonevra nitidula voucher BIOUG16038-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
270 | KR432059 | Diplonevra nitidula voucher BIOUG06081-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
271 | KR641200 | Diplonevra nitidula voucher BIOUG02384-H01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
272 | OQ532359 | Phoridae sp. voucher ZRCBDP0375434 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
273 | KR639519 | Phoridae sp. BOLD-2016 voucher BIOUG02656-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
274 | KR652037 | Diplonevra nitidula voucher BIOUG02722-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
275 | KR752171 | Diplonevra nitidula voucher BIOUG01485-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
276 | KR752075 | Diplonevra nitidula voucher 10PHMAL-1195 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
277 | KR748213 | Diplonevra nitidula voucher 10PHMAL-1238 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
278 | KR749383 | Diplonevra nitidula voucher 10PHMAL-1212 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
279 | KR641258 | Diplonevra nitidula voucher BIOUG02384-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
280 | KR660196 | Diplonevra nitidula voucher BIOUG09135-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
281 | KR643036 | Diplonevra nitidula voucher BIOUG02722-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
282 | KR644885 | Diplonevra nitidula voucher BIOUG02722-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
283 | KT096039 | Diplonevra nitidula voucher BIOUG11003-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
284 | KR657703 | Diplonevra nitidula voucher BIOUG09134-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
285 | KT089820 | Diplonevra nitidula voucher BIOUG11150-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
286 | KT076460 | Diplonevra nitidula voucher BIOUG11245-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
287 | KT092197 | Diplonevra nitidula voucher BIOUG11244-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
288 | KR644796 | Diplonevra nitidula voucher BIOUG02722-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
289 | KR775653 | Diplonevra nitidula voucher BIOUG16101-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
290 | KR778475 | Diplonevra nitidula voucher BIOUG16079-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
291 | KT083420 | Diplonevra nitidula voucher BIOUG11004-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
292 | KT086470 | Diplonevra nitidula voucher BIOUG11017-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
293 | KR770123 | Diplonevra nitidula voucher BIOUG16075-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
294 | KR649481 | Diplonevra nitidula voucher BIOUG02499-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
295 | KR647780 | Diplonevra nitidula voucher BIOUG02656-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
296 | KR744952 | Diplonevra nitidula voucher 10PHMAL-1191 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
297 | KR636264 | Diplonevra nitidula voucher BIOUG02640-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
298 | KR642625 | Diplonevra nitidula voucher BIOUG02722-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
299 | KT706013 | Phoridae sp. BOLD:AAG3236 voucher BIOUG24009-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
300 | KR640813 | Phoridae sp. BOLD-2016 voucher BIOUG02713-H01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
301 | KT090538 | Diplonevra nitidula voucher BIOUG11004-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
302 | KT118429 | Diplonevra nitidula voucher BIOUG02903-E03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
303 | OR924480 | Diplonevra nitidula voucher SMNS_1197059 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
304 | MN410292 | Phoridae sp. isolate UGC0013139 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 525 | 92.1% | 613.011 | 1.35e-170 | 89.7% |
305 | KP044005 | Diplonevra nitidula voucher BIOUG07024-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
306 | MG291912 | Phorinae sp. BIOUG32602-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
307 | KR640473 | Phoridae sp. BOLD-2016 voucher BIOUG02656-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
308 | KT077187 | Diplonevra nitidula voucher BIOUG09956-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
309 | KT081228 | Diplonevra nitidula voucher BIOUG11066-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
310 | KT106226 | Diplonevra nitidula voucher BIOUG01143-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
311 | KP043035 | Diplonevra nitidula voucher BIOUG03996-D01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
312 | KP043609 | Diplonevra nitidula voucher BIOUG03838-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
313 | MZ608729 | Diplonevra nitidula voucher MZH_GV.3216 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
314 | KR665062 | Diplonevra nitidula voucher BIOUG09135-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
315 | OQ530649 | Phoridae sp. voucher ZRCBDP0365085 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
316 | KR430762 | Diplonevra nitidula voucher BIOUG06079-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
317 | HQ979148 | Phoridae sp. BOLD:AAG3236 voucher BIOUG526 |
92.3% |
613.011 |
1.35e-170 |
89.7% |
|
318 | KR660010 | Diplonevra nitidula voucher BIOUG09634-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
319 | KR658987 | Diplonevra nitidula voucher BIOUG08933-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
320 | KR652540 | Diplonevra nitidula voucher BIOUG02640-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
321 | KR663000 | Diplonevra nitidula voucher BIOUG10068-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
322 | KT086165 | Diplonevra nitidula voucher BIOUG14407-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
323 | KT085250 | Phoridae sp. BOLD-2016 voucher BIOUG13375-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
324 | KR672540 | Diplonevra nitidula voucher BIOUG09345-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 613.011 | 1.35e-170 | 89.7% |
325 | MN403866 | Phoridae sp. isolate UGC0004749 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 522 | 91.6% | 607.065 | 8.35e-169 | 89.7% |
326 | MG291856 | Diplonevra nitidula voucher BIOUG27568-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 607.065 | 8.35e-169 | 89.7% |
327 | OQ530375 | Phoridae sp. voucher ZRCBDP0364753 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 522 | 91.6% | 605.082 | 3.30e-168 | 89.7% |
328 | KR770630 | Diplonevra nitidula voucher BIOUG08569-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 522 | 91.6% | 605.082 | 3.30e-168 | 89.7% |
329 | OQ532278 | Phoridae sp. voucher ZRCBDP0375351 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 536 | 94.0% | 616.976 | 8.67e-172 | 89.6% |
330 | OQ530542 | Phoridae sp. voucher ZRCBDP0364952 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 536 | 94.0% | 616.976 | 8.67e-172 | 89.6% |
331 | KR438592 | Megaselia sp. BOLD:AAG3274 voucher BIOUG04290-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 613.011 | 1.35e-170 | 89.6% |
332 | KJ444045 | Megaselia sp. BOLD:AAG3274 voucher BIOUG03749-D01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 613.011 | 1.35e-170 | 89.6% |
333 | KR639330 | Phoridae sp. BOLD-2016 voucher BIOUG02648-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 613.011 | 1.35e-170 | 89.6% |
334 | OR930854 | Megaselia perfusca voucher SMNS_1203843 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 613.011 | 1.35e-170 | 89.6% |
335 | KR649217 | Megaselia rufipes voucher BIOUG02596-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 613.011 | 1.35e-170 | 89.6% |
336 | KU873828 | Phoridae sp. UAM Ento 234170 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 613.011 | 1.35e-170 | 89.6% |
337 | JF867966 | Megaselia sp. BBDCN446-10 voucher BIOUG530 |
93.0% |
613.011 |
1.35e-170 |
89.6% |
|
338 | KR650584 | Megaselia rufipes voucher BIOUG02650-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 613.011 | 1.35e-170 | 89.6% |
339 | KT117235 | Megaselia rufipes voucher BIOUG01434-E05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 613.011 | 1.35e-170 | 89.6% |
340 | KT075944 | Megaselia rufipes voucher BIOUG10528-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 613.011 | 1.35e-170 | 89.6% |
341 | KR633724 | Megaselia rufipes voucher BIOUG02647-E11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 613.011 | 1.35e-170 | 89.6% |
342 | KT116952 | Megaselia rufipes voucher BIOUG01126-C12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 613.011 | 1.35e-170 | 89.6% |
343 | KM646622 | Phoridae sp. BOLD:AAM9371 voucher BIOUG06748-C12 cytochrome oxidase subunit 1 (COI) gene, promoter region and partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
344 | KM907418 | Phoridae sp. BOLD:AAP8722 voucher BIOUG06353-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
345 | KM955196 | Phoridae sp. BOLD:AAP8722 voucher BIOUG06504-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
346 | KT088267 | Phoridae sp. BOLD-2016 voucher BIOUG10714-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
347 | KM962462 | Phoridae sp. BOLD:AAM9371 voucher BIOUG06841-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
348 | KC502706 | Phoridae sp. BOLD:AAP8722 voucher CCDB-08111-E12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
349 | KP039542 | Phoridae sp. BOLD:AAP8722 voucher BIOUG06431-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
350 | KM639260 | Phoridae sp. BOLD:AAP8722 voucher BIOUG09582-H01 cytochrome oxidase subunit 1 (COI) gene, promoter region and partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
351 | KM964472 | Phoridae sp. BOLD:AAP8722 voucher BIOUG06504-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
352 | KC502714 | Phoridae sp. BOLD:AAP8722 voucher CCDB-08111-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
353 | KR430401 | Megaselia sp. BOLD-2016 voucher BIOUG04301-E10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
354 | JF875550 | Megaselia sp. JWDCF776-10 voucher BIOUG529 |
92.8% |
611.029 |
5.35e-170 |
89.6% |
|
355 | KM967341 | Phoridae sp. BOLD:AAP8722 voucher BIOUG06504-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
356 | KR430286 | Megaselia sp. BOLD-2016 voucher BIOUG03572-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
357 | KM913290 | Phoridae sp. BOLD:AAM9371 voucher BIOUG06908-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
358 | KM941011 | Phoridae sp. BOLD:AAP8722 voucher BIOUG04205-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
359 | KM957436 | Phoridae sp. BOLD:AAP8722 voucher BIOUG06512-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
360 | KM956973 | Phoridae sp. BOLD:AAM9371 voucher BIOUG06897-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
361 | KM914472 | Phoridae sp. BOLD:AAM9371 voucher BIOUG06910-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
362 | KC502695 | Phoridae sp. BOLD:AAP8722 voucher CCDB-08111-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
363 | KP039463 | Phoridae sp. BOLD:AAP8722 voucher BIOUG06530-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
364 | KR750805 | Megaselia rufipes voucher BIOUG05719-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
365 | KM967693 | Phoridae sp. BOLD:AAP8722 voucher BIOUG06504-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
366 | KM900515 | Phoridae sp. BOLD:AAP8722 voucher BIOUG09620-D02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
367 | JF875205 | Megaselia sp. JWDCF394-10 voucher BIOUG529 |
92.8% |
611.029 |
5.35e-170 |
89.6% |
|
368 | KX054407 | Phoridae sp. sc_06909 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
369 | KM629267 | Phoridae sp. BOLD:AAM9371 voucher BIOUG06748-A05 cytochrome oxidase subunit 1 (COI) gene, promoter region and partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
370 | MF861454 | Megaselia sp. BIOUG26982-G07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
371 | KR745677 | Megaselia rufipes voucher BIOUG05719-H08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
372 | KP049362 | Phoridae sp. BOLD:AAP8722 voucher BIOUG06531-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
373 | KR472260 | Megaselia sp. BOLD-2016 voucher BIOUG03791-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
374 | MN408445 | Phoridae sp. isolate UGC0003372 cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 528 | 92.6% | 611.029 | 5.35e-170 | 89.6% |
375 | KM919941 | Phoridae sp. BOLD:AAP8722 voucher BIOUG09341-A02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
376 | KR439173 | Phalacrotophora sp. BOLD-2016 voucher BIOUG02056-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
377 | KM629829 | Megaselia sp. BOLD:AAG3274 voucher BIOUG06370-B07 cytochrome oxidase subunit 1 (COI) gene, promoter region and partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
378 | KM944990 | Phoridae sp. BOLD:AAP8722 voucher BIOUG04169-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
379 | KR986669 | Megaselia sp. BOLD-2016 voucher BIOUG19714-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
380 | KM915656 | Phoridae sp. BOLD:AAP8722 voucher BIOUG08706-E03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
381 | KR430192 | Phalacrotophora sp. BOLD-2016 voucher BIOUG02056-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
382 | KT098214 | Megaselia rufipes voucher BIOUG11431-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
383 | KR444991 | Megaselia sp. BOLD-2016 voucher BIOUG04026-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
384 | KR466098 | Megaselia sp. BOLD-2016 voucher BIOUG03794-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
385 | MG105315 | Megaselia sp. BIOUG05657-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
386 | KR473757 | Megaselia sp. BOLD-2016 voucher BIOUG03868-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
387 | KM917399 | Phoridae sp. BOLD:AAP8722 voucher BIOUG07090-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 92.8% | 611.029 | 5.35e-170 | 89.6% |
388 | KR603257 | Megaselia sp. BOLD-2016 voucher BIOUG17504-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 528 | 92.6% | 609.047 | 2.11e-169 | 89.6% |
389 | KR622976 | Megaselia sp. BOLD-2016 voucher BIOUG16922-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 528 | 92.6% | 609.047 | 2.11e-169 | 89.6% |
390 | MG103977 | Megaselia sp. BIOUG24208-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 528 | 92.6% | 609.047 | 2.11e-169 | 89.6% |
391 | MG107482 | Megaselia sp. BIOUG22905-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 528 | 92.6% | 609.047 | 2.11e-169 | 89.6% |
392 | MF870636 | Megaselia sp. BIOUG27574-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 528 | 92.6% | 609.047 | 2.11e-169 | 89.6% |
393 | MF861858 | Megaselia sp. BIOUG26988-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 528 | 92.6% | 609.047 | 2.11e-169 | 89.6% |
394 | MG104608 | Megaselia sp. BIOUG24369-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 528 | 92.6% | 609.047 | 2.11e-169 | 89.6% |
395 | KR598368 | Megaselia sp. BOLD-2016 voucher BIOUG17563-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 528 | 92.6% | 609.047 | 2.11e-169 | 89.6% |
396 | KM918713 | Phoridae sp. BOLD:AAP8722 voucher BIOUG09205-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 528 | 92.6% | 609.047 | 2.11e-169 | 89.6% |
397 | MG109557 | Megaselia sp. BIOUG22904-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 528 | 92.6% | 609.047 | 2.11e-169 | 89.6% |
398 | MG110698 | Megaselia sp. BIOUG22802-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 528 | 92.6% | 609.047 | 2.11e-169 | 89.6% |
399 | KR586255 | Megaselia sp. BOLD-2016 voucher BIOUG17586-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 528 | 92.6% | 609.047 | 2.11e-169 | 89.6% |
400 | KT085792 | Phoridae sp. BOLD-2016 voucher BIOUG12368-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 528 | 92.6% | 609.047 | 2.11e-169 | 89.6% |
401 | KR990214 | Megaselia sp. BOLD-2016 voucher BIOUG19687-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 528 | 92.6% | 609.047 | 2.11e-169 | 89.6% |
402 | MF865074 | Megaselia sp. BIOUG26987-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 528 | 92.6% | 609.047 | 2.11e-169 | 89.6% |
403 | KR991152 | Megaselia sp. BOLD-2016 voucher BIOUG19226-E12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 528 | 92.6% | 609.047 | 2.11e-169 | 89.6% |
404 | MN681761 | Megaselia shatesae voucher CHARS00145-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 528 | 92.6% | 609.047 | 2.11e-169 | 89.6% |
405 | MN676798 | Megaselia shatesae voucher CHARS00257-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 527 | 92.5% | 607.065 | 8.35e-169 | 89.6% |
406 | MN683300 | Megaselia shatesae voucher CHARS00263-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 527 | 92.5% | 607.065 | 8.35e-169 | 89.6% |
407 | MN675193 | Megaselia shatesae voucher CHARS00204-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 527 | 92.5% | 607.065 | 8.35e-169 | 89.6% |
408 | MN668567 | Megaselia shatesae voucher CHARS00205-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 527 | 92.5% | 607.065 | 8.35e-169 | 89.6% |
409 | MN679513 | Megaselia shatesae voucher CHARS00147-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 527 | 92.5% | 607.065 | 8.35e-169 | 89.6% |
410 | MN671140 | Megaselia shatesae voucher CHARS00238-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.6% |
411 | MN682253 | Megaselia shatesae voucher CHARS00238-H01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.6% |
412 | MN666018 | Megaselia shatesae voucher CHARS00254-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.6% |
413 | MN677277 | Megaselia shatesae voucher CHARS00205-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.6% |
414 | MN672220 | Megaselia shatesae voucher CHARS00264-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.6% |
415 | MN676773 | Megaselia shatesae voucher CHARS00259-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.6% |
416 | MN680004 | Megaselia shatesae voucher CHARS00229-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.6% |
417 | MN677892 | Megaselia shatesae voucher CHARS00228-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.6% |
418 | MN666320 | Megaselia shatesae voucher CHARS00206-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.6% |
419 | MN668217 | Megaselia shatesae voucher CHARS00278-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.6% |
420 | MN672076 | Megaselia shatesae voucher CHARS00146-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.6% |
421 | KU873821 | Phoridae sp. UAM Ento 232440 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 533 | 93.5% | 616.976 | 8.67e-172 | 89.5% |
422 | KR692294 | Megaselia sp. BOLD-2016 voucher BIOUG07793-A02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 533 | 93.5% | 611.029 | 5.35e-170 | 89.5% |
423 | OQ529228 | Phoridae sp. voucher ZRCBDP0362951 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 533 | 93.5% | 611.029 | 5.35e-170 | 89.5% |
424 | KR426705 | Megaselia sp. BOLD-2016 voucher BIOUG05769-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 533 | 93.5% | 611.029 | 5.35e-170 | 89.5% |
425 | KR691549 | Megaselia sp. BOLD-2016 voucher BIOUG07117-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 533 | 93.5% | 611.029 | 5.35e-170 | 89.5% |
426 | KM938224 | Megaselia sp. BOLD:ACA8350 voucher BIOUG07069-H08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 533 | 93.5% | 611.029 | 5.35e-170 | 89.5% |
427 | KU873824 | Phoridae sp. UAM Ento 232665 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 533 | 93.5% | 611.029 | 5.35e-170 | 89.5% |
428 | KR467457 | Megaselia sp. BOLD-2016 voucher BIOUG18507-D02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 532 | 93.3% | 609.047 | 2.11e-169 | 89.5% |
429 | MF852870 | Megaselia sp. BIOUG21727-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 532 | 93.3% | 609.047 | 2.11e-169 | 89.5% |
430 | KR991645 | Megaselia sp. BOLD-2016 voucher BIOUG19257-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 532 | 93.3% | 609.047 | 2.11e-169 | 89.5% |
431 | KM628808 | Phoridae sp. BOLD:ACB9084 voucher BIOUG04817-D02 cytochrome oxidase subunit 1 (COI) gene, promoter region and partial cds; mitochondrial | 532 | 93.3% | 609.047 | 2.11e-169 | 89.5% |
432 | KR991779 | Megaselia sp. BOLD-2016 voucher BIOUG19257-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 532 | 93.3% | 609.047 | 2.11e-169 | 89.5% |
433 | MF854698 | Megaselia sp. BIOUG22158-E10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 532 | 93.3% | 609.047 | 2.11e-169 | 89.5% |
434 | MF857028 | Megaselia sp. BIOUG21727-E05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 532 | 93.3% | 609.047 | 2.11e-169 | 89.5% |
435 | MG108946 | Megaselia sp. BIOUG22909-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 531 | 93.2% | 607.065 | 8.35e-169 | 89.5% |
436 | KR502811 | Megaselia sp. BOLD-2016 voucher BIOUG18591-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 531 | 93.2% | 607.065 | 8.35e-169 | 89.5% |
437 | KR652009 | Diplonevra nitidula voucher BIOUG02656-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 607.065 | 8.35e-169 | 89.5% |
438 | KR752065 | Diplonevra nitidula voucher BIOUG01301-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 607.065 | 8.35e-169 | 89.5% |
439 | KR766434 | Diplonevra nitidula voucher BIOUG16090-E03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 607.065 | 8.35e-169 | 89.5% |
440 | KT076735 | Diplonevra nitidula voucher BIOUG11224-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 607.065 | 8.35e-169 | 89.5% |
441 | MG290322 | Phorinae sp. BIOUG32614-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 607.065 | 8.35e-169 | 89.5% |
442 | KR740418 | Diplonevra nitidula voucher BIOUG01301-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.5% |
443 | KT701755 | Phoridae sp. BOLD:AAU6538 voucher BIOUG22717-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.5% |
444 | KT110932 | Diplonevra nitidula voucher BIOUG01124-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.5% |
445 | KR753044 | Phoridae sp. BOLD-2016 voucher BIOUG01301-H08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.5% |
446 | KR751172 | Diplonevra nitidula voucher 10PHMAL-1197 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.5% |
447 | OQ532333 | Phoridae sp. voucher ZRCBDP0375408 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.5% |
448 | KR757117 | Diplonevra nitidula voucher BIOUG01301-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.5% |
449 | KR643979 | Diplonevra nitidula voucher BIOUG02622-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.5% |
450 | KR714503 | Megaselia sp. BOLD-2016 voucher BIOUG13245-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.5% |
451 | MG103809 | Megaselia sp. BIOUG24395-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.5% |
452 | KR747600 | Megaselia sp. BOLD-2016 voucher 10PHMAL-2791 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 526 | 92.3% | 605.082 | 3.30e-168 | 89.5% |
453 | KM940128 | Megaselia sp. BOLD:AAG3274 voucher BIOUG07045-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 609.047 | 2.11e-169 | 89.4% |
454 | KT077295 | Megaselia rufipes voucher BIOUG10414-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
455 | KR637255 | Phoridae sp. BOLD-2016 voucher BIOUG02648-A02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
456 | OR927035 | Megaselia brevicostalis voucher SMNS_1198046 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
457 | KP042056 | Megaselia sp. BOLD:AAG3274 voucher BIOUG02745-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
458 | KR762558 | Megaselia rufipes voucher BIOUG13065-H10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
459 | MG102150 | Megaselia rufipes voucher BIOUG32321-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
460 | KT075900 | Megaselia rufipes voucher BIOUG10829-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
461 | JF879879 | Megaselia rufipes voucher BIOUG530 |
93.0% |
605.082 |
3.30e-168 |
89.4% |
|
462 | KP040787 | Megaselia sp. BOLD:AAG3274 voucher BIOUG06927-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
463 | KR757905 | Megaselia rufipes voucher BIOUG01488-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
464 | KM951269 | Megaselia sp. BOLD:AAG3274 voucher BIOUG06117-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
465 | KP046844 | Megaselia sp. BOLD:AAG3274 voucher BIOUG04102-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
466 | KR645957 | Megaselia rufipes voucher BIOUG02596-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
467 | KR634353 | Megaselia rufipes voucher BIOUG02598-H10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
468 | KM936873 | Megaselia sp. BOLD:AAG3274 voucher BIOUG04255-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
469 | KP047481 | Megaselia sp. BOLD:AAG3274 voucher BIOUG06820-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
470 | KR431321 | Megaselia sp. BOLD:AAG3274 voucher BIOUG03577-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
471 | KR509815 | Phoridae sp. BOLD:AAG3274 voucher BIOUG18367-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
472 | KM956146 | Megaselia sp. BOLD:AAG3274 voucher BIOUG06899-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
473 | OR927603 | Megaselia brevicostalis voucher SMNS_1197907 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
474 | KR719122 | Megaselia rufipes voucher BIOUG13666-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
475 | KT091738 | Megaselia rufipes voucher BIOUG11057-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
476 | KT108762 | Megaselia rufipes voucher BIOUG02828-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
477 | KT077147 | Megaselia rufipes voucher BIOUG10528-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
478 | KM917682 | Megaselia sp. BOLD:AAG3274 voucher BIOUG09292-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
479 | KR637265 | Megaselia sp. BOLD-2016 voucher BIOUG02647-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
480 | KT093051 | Megaselia rufipes voucher BIOUG11319-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
481 | KR642417 | Megaselia rufipes voucher BIOUG02596-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
482 | KT094959 | Megaselia rufipes voucher BIOUG08823-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
483 | KM946552 | Megaselia sp. BOLD:AAG3274 voucher BIOUG07045-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
484 | MG288800 | Megaselia rufipes voucher BIOUG32542-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
485 | OR930861 | Megaselia perfusca voucher SMNS_1205572 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
486 | KT112520 | Megaselia rufipes voucher BIOUG02849-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
487 | KP042007 | Megaselia sp. BOLD:AAG3274 voucher BIOUG06996-H08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
488 | KT101761 | Megaselia rufipes voucher BIOUG02827-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
489 | KM942990 | Megaselia sp. BOLD:AAG3274 voucher BIOUG03481-B07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
490 | KT086023 | Megaselia rufipes voucher BIOUG10509-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
491 | KT707129 | Megaselia rufipes voucher BIOUG24009-G04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
492 | KM969079 | Megaselia sp. BOLD:AAG3274 voucher BIOUG05923-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
493 | KR654953 | Megaselia rufipes voucher BIOUG09927-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
494 | KR751241 | Megaselia rufipes voucher BIOUG09286-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
495 | KR525238 | Megaselia longicostalis voucher BIOUG14430-E12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
496 | KM638582 | Megaselia sp. BOLD:AAG3274 voucher BIOUG07039-F11 cytochrome oxidase subunit 1 (COI) gene, promoter region and partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
497 | KP045808 | Megaselia sp. BOLD:AAG3274 voucher BIOUG07024-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
498 | KM932251 | Megaselia sp. BOLD:AAG3274 voucher BIOUG07573-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 93.0% | 605.082 | 3.30e-168 | 89.4% |
499 | OM314455 | Phoridae sp. voucher BIOUG24772-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 535 | 93.9% | 607.065 | 8.35e-169 | 89.3% |
500 | OM594213 | Phoridae sp. voucher BIOUG23828-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 535 | 93.9% | 607.065 | 8.35e-169 | 89.3% |
Selected alignment ⓘ
Selected taxonomy ⓘ
Domain | |
---|---|
Kingdom | |
Phylum | |
Class | |
Order | |
Family | |
Genus | |
Species |
This sections shows the taxa of interest (TOI) specified by the sample submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity | Database coverage | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Megaselia scalaris | Did not match any candidate |
Database coverage of Taxon of Interest Megaselia scalarisThis Taxon of Interest has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Reference database:
Database coverage of Megaselia scalaris
Flag 5.1A:
The reference data supports this taxon well
185 records
There are 185 sequence records in the reference database for Megaselia scalaris that have been annotated with the given locus COI. It is possible that more records exist for this taxon which were not correctly annotated with this locus.
Global occurrence records for Megaselia scalaris.
Database coverage of species in genus Megaselia
Flag 5.2B:
The reference data offers some support for species in this genus
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COI Database coverage of species in genus Megaselia that occur in country of origin India
Flag 5.3B:
The reference data offers some support for species in this genus, when we evaluate only species that occur in the sample's country of origin
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COI |
This analysis evaluates how many independent publication events have contributed matching sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
Candidates
Independent publication sources
(Found 1 sources)
1 Independent Source
The matching reference sequences for this species have been annotated by 1 independent source(s). A source is considered independent if the author list or publication title is distinct.
Source 1
Hit accession | Automated ⓘ | Authors | Title | Journal |
---|---|---|---|---|
KR666968 | False |
Hebert,P.D. Ratnasingham,S. Zakharov,E.V. Telfer,A.C. Levesque-Beaudin,V. Milton,M.A. Pedersen,S. Jannetta,P. deWaard,J.R. |
Counting animal species with DNA barcodes: Canadian insects | Philos. Trans. R. Soc. Lond., B, Biol. Sci. 371 (1702) (2016) In press |
KR666968 | False |
Hebert,P.D.N. Ratnasingham,S. Zakharov,E.V. Dewaard,J.R. |
Direct Submission | Submitted (11-MAY-2015) Biodiversity Institute of Ontario, University of Guelph, 50 Stone Road EAST, Guelph, Ontario N1G2W1, Canada |
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species" clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
Click + drag
to pan
Scroll
to zoom in/out
Click
a label to view NCBI record
This phylogenetic tree shows the genetic relationship between the query sequence
(labelled QUERY
)
and matching reference sequences (labelled species/accession).
The tree was computed with
FastME
using the Neighbor-Joining method. Multiple-sequence alignment of the candidate reference sequences was performed using
MAFFT.
The visualization is rendered with
Phylocanvas.GL
.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
Taxa | Database |
---|---|
General | GBIF |
General | ITIS |
Mealybugs & scale | ScaleNet database |
Thrips | Thripswiki |
Spider Mites | Spider Mites Database |
Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
Orthoptera | Orthoptera Species File Online |
Drosophilidae | TaxoDros |
Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
Aphids | Aphid Species File |
Ants |
AntWeb
AntCat |
Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
Tortricidae (tortrix moths) | Tortricidae Resources on the Net |
The following table lists all flags that were raised during the analysis. The Flag column indicates the flag number and value, while the Outcome column describes the outcome of the analysis for that flag. The Level column indicates the severity of the flag, with levels >1 indicating increasing level of concern.
Flag | Analysis | Explanation | Outcome | Level |
---|---|---|---|---|
1A | Candidate selection | 1 candidate species matched with high stringency (identity ≥ 98.5%) | Positive species identification | 1 |
1B | Candidate selection | 2-3 candidate species matched with high stringency (identity ≥ 98.5%) | The analyst should attempt subjective species identification at the genus level | 2 |
1C | Candidate selection | >3 candidate species matched with high stringency (identity ≥ 98.5%) | The analyst should attempt subjective species identification at the genus level | 3 |
1D | Candidate selection | At least one candidate species matched with moderate stringency (identity ≥93.5% and <98.5%) | The analyst should attempt subjective species identification at the genus level | 2 |
1E | Candidate selection | No candidate species matched | Identification not possible (potential unknown species) | 3 |
2A | Taxa of interest analysis | Taxon of interest detected in candidate species | At least one of the taxa of interest matched the candidates species | 1 |
2B | Taxa of interest analysis | Taxon of interest NOT detected in candidate species | None of the taxa of interest matched the candidates species | 3 |
2NA | Taxa of interest analysis | No Taxa of Interest were provided | Could not be assessed | 0 |
4A | Supporting publications | Matching sequence records for this species are from >5 independent sources | Reference sequences are from diverse sources and therefore likely to be reliable | 1 |
4B | Supporting publications | Matching sequence records for this species have only 1-5 independent sources | Reference sequence sources lack diversity and may therefore be unreliable | 2 |
5NA | Database coverage | Criteria to perform this analysis were not met | Database coverage could not be assessed for this taxon. | 0 |
5B | Database coverage | Locus was not provided for this sample | Database coverage could not be fully assessed for this taxon. | 2 |
5.1A | Database representation for target taxon | The given locus for this taxon is well represented in reference database (>5 entries) | The reference data supports this taxon well | 1 |
5.1B | Database representation for target taxon | The given locus for this taxon has limited representation in reference database (≤5 entries) | The reference data has some support for this taxon | 2 |
5.1C | Database representation for target taxon | The given locus for this taxon is not present in reference database (0 entries) | The reference data are likely to be unreliable for this species | 3 |
5.1NA | Database representation for target taxon | Assessment of related species is only possible for taxa at rank genus/species | This taxon could not be fully assessed | 0 |
5.2A | Database representation for related species | >90% of related taxa have reference sequence(s) at the given locus | The reference data supports species in this genus well | 1 |
5.2B | Database representation for related species | 10-90% of related taxa have reference sequence(s) at the given locus | The reference data offers some support for species in this genus | 2 |
5.2C | Database representation for related species | ≤10% of taxon have reference sequence(s) at the given locus | The reference data offers little support for species in this genus | 3 |
5.2NA | Database representation for related species | Assessment of related species is only possible for taxa at rank genus/species | This taxon could not be fully assessed | 0 |
5.3A | Database representation for related species in country of origin | All species in genus from country of origin have reference sequence(s) for this locus | The reference data supports species in this genus well, when we evaluate only species that occur in the sample's country of origin | 1 |
5.3B | Database representation for related species in country of origin | Not all species in genus from the country of origin have reference sequence(s) for this locus | The reference data offers some support for species in this genus, when we evaluate only species that occur in the sample's country of origin | 2 |
5.3C | Database representation for related species in country of origin | No species in genus have been observed in the country of origin | It's unlikely that the true taxonomic identity is another species in this genus, because no others have been recorded in the sample's country of origin | 0 |
5.3NA | Database representation for related species in country of origin | Assessment of related species is only possible for taxa at rank genus/species | This taxon could not be fully assessed | 0 |
6A | Phylogenetic assessment | Candidate species grouped within single clade | The query sequence is genetically consistent with sequences of the best-matching species | 1 |
6B | Phylogenetic assessment | The query sequence clusters as sister to a species-specific clade or as a single branch in a tree | The sample is genetically distinct from the sequences of the best-matching species, and may lack representation in the reference database. This indicates that the sample organism is either poorly studied or a potential novel species. | 2 |
6C | Phylogenetic assessment | Genotype diversity grouped into multiple diverse groups | The top candidate species cannot be confidently distinguished from other related species | 3 |
7A | Preliminary identification confirmation | Identified species is consistent with preliminary ID | The preliminary identification is supported by the molecular data | 1 |
7B | Preliminary identification confirmation | Identified species is not consistent with preliminary ID | The molecular data contradicts the preliminary identification | 3 |
7NA | Preliminary identification confirmation | Insufficient evidence due to inconclusive taxonomy of the sample | Cannot confirm or reject the preliminary ID | 0 |