Sample ID: LC438549.1
Reference database: BLAST
Report generated from the Taxonomic Identification Nextflow workflow. The analysis is fully documented here.
Facility | Cairns Airport |
Analyst | John Doe |
Analysis start | 2025-08-17 15:18:16 |
Analysis end | 2025-08-22 19:36:56 |
Wall time |
124:18:40
hours
|
This report describes the results of a taxonomic identification analysis for the sample
LC438549.1
.
The analysis compares the sample's DNA sequence against a reference database of sequences with known taxonomy.
The results include the best matches from the database, which are referred to as "Candidates". To provide rigour, the report also includes an analysis of supporting publications (a measure of the integrity of candidate hit sequences), and database coverage of the different taxa that are of interest to the report.
Sample ID | LC438549.1 |
Locus | COI |
Preliminary ID | Asterias rubens |
Taxa of interest |
Asteridae Acanthaster planci |
Country | Japan |
Host | driftwood |
Sequencing platform | nanopore |
Query DNA sequence | View |
>LC438549.1 Anneissia japonica mitochondrial COX1 mRNA for cytochrome c oxidase subunit 1, partial cds GGTAAAAAAAATGAGTTTTTGGCTTTTGCCTCCTTCTTTTCTTCTTTTATTGGCTTCTGC TGGTGTTGAAAGGGGTGTTGGTACTGGGTGAACTATTTATCCTCCTTTGTCAAGTGGTAT TGCTCATTCTGGTGGTTCTGTTGATCTTGCTATTTTTTCTTTACATATAGCTGGTGCTTC TTCTATTATAGCTTCGATTAACTTTATAACTACAATAATAAAAATGCGTGCTCCTGGTAT TTCTTTTGATCGTCTTTCTCTTTTTGTTTGATCAATTTTTATTACTACTTTTCTTCTTTT GTTATCTTTACCTGTTTTGGCTGGGGCTATAACAATGCTTCTTACTGATCGTAATGTAAA TACTACTTTTTTTGATCCTGCTGGTGGTGGTGATCCTATTTTGTTTCAGCATTTATTTTG GTTTTTTGGTCATCCTGAAGTTTATATTTTAATATTACCTGGTTTTGGTATGATTTCTCA TGTTGTTTCTCATTATTCTGGTAAGAGAGAGCCTTTTGGTTATTTGGGTATGGTTTATGC GATGGTTGCTATAGGTATACTTGGTTTTCTTGTTTGAGCACATCATATGTTTACTGTAGG TA
metadata
|
metadata.csv
|
outdir
|
output_v025
|
publish_dir_mode
|
None
|
email
|
None
|
email_on_fail
|
None
|
plaintext_email
|
False
|
monochrome_logs
|
False
|
help
|
False
|
help_full
|
False
|
show_hidden
|
False
|
version
|
False
|
pipelines_testdata_base_path
|
https://raw.githubusercontent.com/nf-core/test-datasets/
|
trace_report_suffix
|
2025-05-21_07-46-56
|
config_profile_name
|
None
|
config_profile_description
|
None
|
custom_config_version
|
master
|
sequences
|
query.fasta
|
blastdb
|
/home/ubuntu/blastdbs/20250329/core_nt
|
taxdb
|
/home/ubuntu/.taxonkit/
|
ncbi_api_key
|
d2c2e49b459493d627948bc7d5a07fca5c08
|
user_email
|
magdalena.antczak@qcif.edu.au
|
analyst_name
|
Magdalena Antczak
|
facility_name
|
QCIF
|
custom_config_base
|
https://raw.githubusercontent.com/nf-core/configs/master
|
config_profile_contact
|
None
|
config_profile_url
|
None
|
validate_params
|
True
|
accessions_filename
|
accessions.txt
|
taxonomy_filename
|
taxonomy.csv
|
query_title_filename
|
query_title.txt
|
hits_json_filename
|
hits.json
|
hits_fasta_filename
|
all_blast_hits.fasta
|
flags_csv_filename
|
flags.json
|
taxonomy_id_filename
|
assigned_taxonomy.txt
|
candidates_fasta_filename
|
candidates.fasta
|
candidates_csv_filename
|
candidates.csv
|
candidates_json_filename
|
candidates.json
|
toi_detected_csv_filename
|
taxa_of_concern_detected.csv
|
min_nt
|
400
|
min_q_coverage
|
0.85
|
min_identity
|
0.935
|
min_identity_strict
|
0.985
|
timestamp_filename
|
timestamp.txt
|
pmi_match_csv_filename
|
pmi_match_results.csv
|
candidates_sources_json_filename
|
candidates_sources.json
|
db_coverage_json_filename
|
db_coverage.json
|
gbif_accepted_status
|
accepted,doubtful
|
gbif_limit_records
|
500
|
tree_nwk_filename
|
candidates.nwk
|
boxplot_img_filename
|
candidates_identity_boxplot.png
|
allowed_loci_file
|
/home/ubuntu/nextflow-pipeline/daff-taxassignwf/scripts/config/loci.json
|
blast
|
2.16.0+
|
fastme
|
2.1.6.3
|
mafft
|
7.52
|
daff/taxassignwf
|
v0.2.5
|
Nextflow
|
24.10.6
|
Anneissia japonica
Candidate species | |||||
---|---|---|---|---|---|
Candidate Species | Hits | Sources | Max Identity | Min Identity | Genus Coverage |
Anneissia japonica | 3 | 3 | 100.0% | 100.0% | 56% |
Preliminary ID | ||||
---|---|---|---|---|
Species | Confirmed? | DB records | Genus coverage | Coverage report |
Asterias rubens |
|
143 | 16% |
|
Outcome:
The molecular data contradicts the preliminary identification.
Reasoning: Identified species is not consistent with preliminary ID. |
This Preliminary Morphology ID has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error).
For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Reference database:
NCBI Core Nt
Coverage of Asterias rubens | |
Coverage of species in genus Asterias | |
Coverage of species in genus Asterias in country of origin Japan |
Flag 5.1A:
The reference data supports this taxon well
Reasoning: The given locus for this taxon is well represented in reference database (>5 entries)
There are 143 sequence records in the reference database for Asterias rubens that have been annotated with the given locus COI. It is possible that more records exist for this taxon which were not correctly annotated with this locus.
Global occurrence records for Asterias rubens.
Note that the occurrence data are not exhaustive, since the data fetched are limited to 5000 occurrence records.
It is therefore possible for this species to occur in regions not shown on the map.
Flag 5.2B:
The reference data offers some support for species in this genus
Reasoning: 10-90% of related taxa have reference sequence(s) at the given locus
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COI
Flag 5.3B:
The reference data offers some support for species in this genus, when we evaluate only species that occur in the sample's country of origin
Reasoning: Not all species in genus from the country of origin have reference sequence(s) for this locus
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COI
Taxa of Interest | ||||
---|---|---|---|---|
Taxon | Detected? | DB Records | Genus Coverage | Coverage report |
Asteridae |
|
- | - |
|
Acanthaster planci |
|
524 | 75% |
|
Outcome:
None of the taxa of interest matched the candidates species.
Reasoning: Taxon of interest NOT detected in candidate species. |
This Taxa of Interest has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error).
For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Reference database:
NCBI Core Nt
No GBIF record found for 'Asteridae'. Taxonomic records cannot be retrieved for this species name - please check that this species name is correct.
No database coverage information is available for this taxon. This is likely because the data are insufficient or inappropriate for this analysis, or because an error was encountered during the analysis.
This Taxa of Interest has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error).
For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Reference database:
NCBI Core Nt
Coverage of Acanthaster planci | |
Coverage of species in genus Acanthaster | |
Coverage of species in genus Acanthaster in country of origin Japan |
Flag 5.1A:
The reference data supports this taxon well
Reasoning: The given locus for this taxon is well represented in reference database (>5 entries)
There are 524 sequence records in the reference database for Acanthaster planci that have been annotated with the given locus COI. It is possible that more records exist for this taxon which were not correctly annotated with this locus.
Global occurrence records for Acanthaster planci.
Note that the occurrence data are not exhaustive, since the data fetched are limited to 5000 occurrence records.
It is therefore possible for this species to occur in regions not shown on the map.
Flag 5.2B:
The reference data offers some support for species in this genus
Reasoning: 10-90% of related taxa have reference sequence(s) at the given locus
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COI
Flag 5.3A:
The reference data supports species in this genus well, when we evaluate only species that occur in the sample's country of origin
Reasoning: All species in genus from country of origin have reference sequence(s) for this locus
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COI
ⓘ BLAST hits must meet ONE of these criteria to be considered for candidate screening:
Minimum alignment length ⓘ |
300bp
|
Minimum query coverage ⓘ |
85.0%
|
ⓘ BLAST hits have been classified as follows:
Classification | Alignment identity ⓘ | Number of hits ⓘ | Number of species ⓘ |
---|---|---|---|
STRONG MATCH | ≥ 98.5% | 3 | 1 |
MODERATE MATCH | ≥ 93.5% | 17 | 4 |
NO MATCH | < 93.5% | 480 | 82 |
Lowest identity of all 500 BLAST hits: 87.5%
Species | No. hits ⓘ | Top identity ⓘ | Median identity ⓘ | Min identity ⓘ | Top E-value ⓘ | Coverage ⓘ | Publications ⓘ | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Anneissia japonica | 3 | 100.0% | 100.0% | 100.0% | 0.0 |
Database coverage of Candidate Anneissia japonicaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Reference database:
Database coverage of Anneissia japonica
Flag 5.1A:
The reference data supports this taxon well
16 records
There are 16 sequence records in the reference database for Anneissia japonica that have been annotated with the given locus COI. It is possible that more records exist for this taxon which were not correctly annotated with this locus.
Global occurrence records for Anneissia japonica.
Database coverage of species in genus Anneissia
Flag 5.2B:
The reference data offers some support for species in this genus
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COI Database coverage of species in genus Anneissia that occur in country of origin Japan
Flag 5.3B:
The reference data offers some support for species in this genus, when we evaluate only species that occur in the sample's country of origin
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COI |
This analysis evaluates how many independent publication events have contributed matching sequences for Anneissia japonica. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
(Found 3 sources)
3 Independent Sources
The matching reference sequences for this species have been annotated by 3 independent source(s). A source is considered independent if the author list or publication title is distinct.
Source 1
Hit accession | Automated ⓘ | Authors | Title | Journal |
---|---|---|---|---|
XM_033267091 | True | No publications for this record |
Source 2
Hit accession | Automated ⓘ | Authors | Title | Journal |
---|---|---|---|---|
LC438549 | False |
Omori,A. Shibata,T.F. Akasaka,K. |
Gene expression analysis of three homeobox genes throughout early and late development of a feather star Anneissia japonica | Dev Genes Evol 230 (4), 305-314 (2020) |
LC438549 | False |
Omori,A. Shibata,T.F. Akasaka,K. |
Direct Submission | Submitted (11-DEC-2018) Contact:Akihito Omori Niigata University, Sado Marine Biological Station; 87 Tassha, Sado, Niigata 952-2135, Japan URL :https://www.sc.niigata-u.ac.jp/sc/sadomarine/ |
Source 3
Hit accession | Automated ⓘ | Authors | Title | Journal |
---|---|---|---|---|
GU327860 | False |
Rouse,G.W. Jermiin,L. Wilson,N.G. Ameziane,N. Oji,T. Young,C. Cisternas,P. Browning,T. Helgen,L. Stuckey,M. Messing,C.G. |
Fixed, free and fixed: The phylogeny of extant crinoids and the origin of Articulata | Unpublished |
GU327860 | False | Rouse,G.W. | Direct Submission | Submitted (16-DEC-2009) Marine Biology Research Division, Scripps Institution of Oceanography, University of California San Diego, 9500 Gilman Drive, La Jolla, CA 92093-0202, USA |
This table shows all results that were returned by the BLAST search.
Each row represents a reference sequence that matched the query
sequence.
Use CTRL+F
to search the table, and click table headers
to sort by column. Click on a row to show the corresponding BLAST
alignment and taxonomy information in the bottom panes.
Rank ⓘ | Accession ⓘ | Hit subject ⓘ | Align length ⓘ | Identity ⓘ | Bitscore ⓘ | E-value ⓘ | Query coverage ⓘ |
---|---|---|---|---|---|---|---|
1 | XM_033267091 | PREDICTED: Anneissia japonica cytochrome c oxidase subunit 1-like (LOC117121782), mRNA | 602 | 100.0% | 1112.8 | 0.00e+00 | 100.0% |
2 | LC438549 | Anneissia japonica mitochondrial COX1 mRNA for cytochrome c oxidase subunit 1, partial cds | 602 | 100.0% | 1112.8 | 0.00e+00 | 100.0% |
3 | GU327860 | Oxycomanthus japonicus cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 99.7% | 1101.72 | 0.00e+00 | 100.0% |
4 | NC_054279 | Anneissia pinguis mitochondrion, complete genome | 602 | 97.7% | 1035.24 | 0.00e+00 | 100.0% |
5 | MT086598 | Anneissia pinguis isolate EC2019121400 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 412 | 97.3% | 701.001 | 0.00e+00 | 68.4% |
6 | MT086593 | Anneissia pinguis isolate EC2019116395 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 412 | 97.3% | 701.001 | 0.00e+00 | 68.4% |
7 | MT086592 | Anneissia pinguis isolate EC2019115394 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 412 | 97.3% | 701.001 | 0.00e+00 | 68.4% |
8 | MT086597 | Anneissia pinguis isolate EC2019120399 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 412 | 97.3% | 701.001 | 0.00e+00 | 68.4% |
9 | MT086595 | Anneissia pinguis isolate EC2019118397 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 412 | 97.3% | 701.001 | 0.00e+00 | 68.4% |
10 | MT086596 | Anneissia pinguis isolate EC2019119398 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 412 | 97.3% | 701.001 | 0.00e+00 | 68.4% |
11 | MT086594 | Anneissia pinguis isolate EC2019117396 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 412 | 97.3% | 701.001 | 0.00e+00 | 68.4% |
12 | KR010356 | Anneissia bennetti voucher UF:UF10627 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 508 | 94.7% | 789.64 | 0.00e+00 | 84.4% |
13 | OP897984 | Comanthus sp. AB49142178 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 506 | 94.7% | 785.946 | 0.00e+00 | 84.1% |
14 | KJ875015 | Anneissia bennetti voucher AM:J.25414 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 94.3% | 922.598 | 0.00e+00 | 99.8% |
15 | KR010352 | Anneissia bennetti voucher DNA spm RA620 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 94.2% | 918.905 | 0.00e+00 | 100.0% |
16 | KR010354 | Anneissia bennetti voucher MNHN:IE-2013-8157 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 93.7% | 902.285 | 0.00e+00 | 100.0% |
17 | KR010355 | Anneissia bennetti voucher MNHN:IE-2013-8058 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 93.7% | 902.285 | 0.00e+00 | 100.0% |
18 | KR010353 | Anneissia bennetti voucher MNHN:IE-2013-8084 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 93.7% | 902.285 | 0.00e+00 | 100.0% |
19 | GQ913314 | Oxycomanthus bennetti cytochrome oxidase subunit I-like (COI) gene, partial sequence; mitochondrial | 602 | 93.7% | 902.285 | 0.00e+00 | 100.0% |
20 | KJ875020 | Phanogenia multibrachiata voucher SAMA:K1947 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 93.7% | 900.439 | 0.00e+00 | 99.8% |
21 | KJ875022 | Neocomatella pulchella voucher HBOI cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 93.2% | 883.819 | 0.00e+00 | 99.8% |
22 | KR010251 | Comanthus briareus voucher SAM601 |
93.2% |
883.819 |
0.00e+00 |
99.8% |
|
23 | KJ875019 | Phanogenia gracilis voucher MNHN:IE-2013-8039 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 93.1% | 874.586 | 0.00e+00 | 99.0% |
24 | KR010246 | Comanthus sp. 5 MS-2016 voucher SIO:BIC:E6145 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 562 | 93.1% | 822.879 | 0.00e+00 | 93.4% |
25 | KR010245 | Comanthus sp. 5 MS-2016 voucher UF:UF10620 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 547 | 93.1% | 800.72 | 0.00e+00 | 90.9% |
26 | NC_007690 | Phanogenia gracilis mitochondrion, complete genome | 596 | 93.0% | 869.046 | 0.00e+00 | 99.0% |
27 | KR010247 | Comanthus gisleni voucher DNA spm RA675 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 92.9% | 874.586 | 0.00e+00 | 100.0% |
28 | GU327856 | Comanthus gisleni cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 92.9% | 874.586 | 0.00e+00 | 100.0% |
29 | KR010261 | Comanthus parvicirrus voucher SIO:BIC:E6242 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 577 | 92.9% | 839.499 | 0.00e+00 | 95.8% |
30 | KJ875021 | Comatulella brachiolata voucher SAMA K2340 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 92.8% | 872.739 | 0.00e+00 | 99.8% |
31 | KR010253 | Comanthus sp. 4 MS-2014 voucher MNHN:IE-2013-8038 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 92.7% | 869.046 | 0.00e+00 | 100.0% |
32 | KJ875000 | Comanthus suavia voucher SIO:BIC:E5876 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 92.7% | 869.046 | 0.00e+00 | 100.0% |
33 | KR010269 | Comanthus parvicirrus voucher MNHN:IE-2013-8035 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 92.7% | 867.199 | 0.00e+00 | 99.8% |
34 | KJ874997 | Comanthus parvicirrus voucher SAMA:K2253 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 92.7% | 867.199 | 0.00e+00 | 99.8% |
35 | KR010304 | Phanogenia typica voucher SIO:BIC:E6089 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 92.6% | 857.966 | 0.00e+00 | 99.0% |
36 | KR010294 | Phanogenia gracilis voucher SIO:BIC:E6305 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 92.6% | 857.966 | 0.00e+00 | 99.0% |
37 | KR010305 | Phanogenia typica voucher MNHN:IE-2013-8119 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 92.6% | 857.966 | 0.00e+00 | 99.0% |
38 | KR010297 | Phanogenia typica voucher SIO:BIC:E6306 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 557 | 92.6% | 802.566 | 0.00e+00 | 92.5% |
39 | KR010262 | Comanthus parvicirrus voucher SIO:BIC:E6235 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 92.5% | 863.506 | 0.00e+00 | 99.8% |
40 | KR010252 | Comanthus sp. 4 MS-2014 voucher MNHN:IE-2013-8015 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 92.5% | 863.506 | 0.00e+00 | 100.0% |
41 | KR010254 | Comanthus sp. 4 MS-2014 voucher MNHN:IE-2013-8044 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 92.5% | 863.506 | 0.00e+00 | 100.0% |
42 | KJ874996 | Comanthus sp. 4 MS-2014 voucher MNHN:IE-2013-8048 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 92.5% | 863.506 | 0.00e+00 | 100.0% |
43 | KR046223 | Comanthus suavia voucher SIO:BIC:spm 362 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 92.5% | 863.506 | 0.00e+00 | 100.0% |
44 | KR010268 | Comanthus parvicirrus voucher MNHN:IE-2013-8117 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 92.5% | 861.659 | 0.00e+00 | 99.8% |
45 | KR010266 | Comanthus parvicirrus voucher SAM601 |
92.5% |
861.659 |
0.00e+00 |
99.8% |
|
46 | MW526392 | Comanthus parvicirrus mitochondrion, complete genome | 601 | 92.5% | 861.659 | 0.00e+00 | 99.8% |
47 | KR010270 | Comanthus parvicirrus voucher MNHN:IE-2013-8041 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 92.5% | 861.659 | 0.00e+00 | 99.8% |
48 | NC_060843 | Comanthus parvicirrus mitochondrion, complete genome | 601 | 92.5% | 861.659 | 0.00e+00 | 99.8% |
49 | KJ874994 | Comanthus briareus voucher SAMA:K2268 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 92.5% | 861.659 | 0.00e+00 | 99.8% |
50 | GQ913315 | Phanogenia gracilis cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 593 | 92.4% | 846.886 | 0.00e+00 | 98.5% |
51 | KR010306 | Phanogenia typica voucher SAM593 |
92.4% |
846.886 |
0.00e+00 |
98.5% |
|
52 | KJ875004 | Comaster schlegelii voucher SAMA:K1955 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 92.3% | 856.119 | 0.00e+00 | 99.8% |
53 | GU327855 | Comaster audax cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 92.3% | 856.119 | 0.00e+00 | 99.8% |
54 | KR010302 | Phanogenia typica voucher DNA spm C321 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 92.3% | 846.886 | 0.00e+00 | 99.0% |
55 | KJ875003 | Comaster multifidus voucher SAMA:K2514 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 92.2% | 852.426 | 0.00e+00 | 100.0% |
56 | KR010331 | Comaster multifidus voucher SAM602 |
92.2% |
852.426 |
0.00e+00 |
100.0% |
|
57 | KR010312 | Capillaster sentosus voucher MNHN:IE-2013-8066 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 92.2% | 850.579 | 0.00e+00 | 99.8% |
58 | MW526391 | Comaster schlegelii mitochondrion, complete genome | 601 | 92.2% | 850.579 | 0.00e+00 | 99.8% |
59 | KJ874999 | Comanthus sp. 3 MS-2014 voucher MNHN:IE-2013-8030 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 92.2% | 850.579 | 0.00e+00 | 99.8% |
60 | MW868294 | Comaster schlegelii mitochondrion, complete genome | 601 | 92.2% | 850.579 | 0.00e+00 | 99.8% |
61 | KR010341 | Comaster schlegelii voucher SIO:BIC:E6260 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 92.2% | 850.579 | 0.00e+00 | 99.8% |
62 | KR010300 | Phanogenia typica voucher SIO:BIC:E6094 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 92.1% | 841.346 | 0.00e+00 | 99.0% |
63 | KR010263 | Comanthus parvicirrus voucher SIO:BIC:spm C359 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 92.1% | 841.346 | 0.00e+00 | 99.0% |
64 | KR010298 | Phanogenia typica voucher SIO:BIC:E6095 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 92.1% | 841.346 | 0.00e+00 | 99.0% |
65 | KR010310 | Capillaster sentosus voucher DNA spm RA404 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 580 | 92.1% | 817.339 | 0.00e+00 | 96.3% |
66 | KR010344 | Comaster schlegelii voucher MNHN:IE-2013-8147 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 92.0% | 845.039 | 0.00e+00 | 99.8% |
67 | KR010346 | Comaster schlegelii voucher UF:UF12142 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 92.0% | 845.039 | 0.00e+00 | 99.8% |
68 | GQ913317 | Comanthina schlegelii cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 92.0% | 845.039 | 0.00e+00 | 99.8% |
69 | KR010347 | Comaster schlegelii voucher UF:UF10624 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 92.0% | 845.039 | 0.00e+00 | 99.8% |
70 | PP735417 | Capillaster multiradiatus isolate CM4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 600 | 92.0% | 843.193 | 0.00e+00 | 99.7% |
71 | OM272942 | Comanthus sp. 2 MS-2014 mitochondrion, complete genome | 602 | 91.9% | 841.346 | 0.00e+00 | 100.0% |
72 | KR010221 | Clarkcomanthus sp. MS-2016 voucher SIO:BIC:E6244 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 91.9% | 841.346 | 0.00e+00 | 100.0% |
73 | KR010301 | Phanogenia typica voucher SIO:BIC:E6092 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 91.9% | 835.806 | 0.00e+00 | 99.0% |
74 | KR010299 | Phanogenia typica voucher MNHN:IE-2013-8091 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 91.9% | 835.806 | 0.00e+00 | 99.0% |
75 | KJ875001 | Comanthus sp. 1 MS-2014 voucher SAMA:K2006 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 91.9% | 835.806 | 0.00e+00 | 99.0% |
76 | KJ875017 | Phanogenia typica voucher SAMA:K1984 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 91.9% | 835.806 | 0.00e+00 | 99.0% |
77 | KR010307 | Capillaster sentosus voucher LIPI spm 370 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 559 | 91.9% | 784.1 | 0.00e+00 | 92.9% |
78 | OP897987 | Comanthus wahlbergii voucher AB49103187 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 91.9% | 774.866 | 0.00e+00 | 92.0% |
79 | KR010250 | Comanthus sp. 2 MS-2014 voucher MNHN:IE-2013-8037 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.8% | 839.499 | 0.00e+00 | 99.8% |
80 | KR010345 | Comaster schlegelii voucher MNHN:IE-2013-8178 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.8% | 839.499 | 0.00e+00 | 99.8% |
81 | KR010249 | Comanthus sp. 2 MS-2014 voucher MNHN:IE-2013-8016 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.8% | 839.499 | 0.00e+00 | 99.8% |
82 | KR010311 | Capillaster sentosus voucher AM:J25424 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.8% | 839.499 | 0.00e+00 | 99.8% |
83 | GU327854 | Cenolia trichoptera cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.8% | 839.499 | 0.00e+00 | 99.8% |
84 | KR010338 | Comaster schlegelii voucher SIO:BIC:E6261 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.8% | 839.499 | 0.00e+00 | 99.8% |
85 | KJ874983 | Capillaster sentosus voucher SIO:BIC:E5873 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.8% | 839.499 | 0.00e+00 | 99.8% |
86 | KJ874985 | Cenolia glebosus voucher SIO:BIC:E4712 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.8% | 839.499 | 0.00e+00 | 99.8% |
87 | KR010343 | Comaster schlegelii voucher SAM601 |
91.8% |
839.499 |
0.00e+00 |
99.8% |
|
88 | KR010295 | Phanogenia gracilis voucher SIO:BIC:E6528 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.8% | 839.499 | 0.00e+00 | 99.8% |
89 | LC580405 | Capillaster multiradiatus TT60 mitochondrial COX1 gene for cytochrome c oxidase subunit 1, partial cds | 583 | 91.8% | 811.799 | 0.00e+00 | 96.8% |
90 | KR010317 | Capillaster multiradiatus voucher MNHN:IE-2013-8127 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 91.7% | 835.806 | 0.00e+00 | 100.0% |
91 | KM491781 | Capillaster cf. multiradiatus MMS-2014 voucher MNHN:IE-2013-8127 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 91.7% | 835.806 | 0.00e+00 | 100.0% |
92 | KR010255 | Comanthus wahlbergii voucher SAM601 |
91.7% |
833.959 |
0.00e+00 |
99.8% |
|
93 | KR010337 | Comaster schlegelii voucher SIO:BIC:E6262 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.7% | 833.959 | 0.00e+00 | 99.8% |
94 | KR010342 | Comaster schlegelii voucher AM:J25409 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.7% | 833.959 | 0.00e+00 | 99.8% |
95 | KR010339 | Comaster schlegelii voucher SIO:BIC:spm 364 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.7% | 833.959 | 0.00e+00 | 99.8% |
96 | KR010325 | Capillaster multiradiatus voucher MNHN:IE-2013-8045 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 593 | 91.7% | 824.726 | 0.00e+00 | 98.5% |
97 | KR010308 | Capillaster sentosus voucher LIPI spm 369 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 556 | 91.7% | 773.02 | 0.00e+00 | 92.4% |
98 | OP897998 | Comanthus wahlbergii voucher AB49103150 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 506 | 91.7% | 702.847 | 0.00e+00 | 84.1% |
99 | KJ874991 | Comactinia meridionalis voucher UF:11709 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 597 | 91.6% | 826.573 | 0.00e+00 | 99.2% |
100 | KR010303 | Phanogenia typica voucher SIO:BIC:E6096 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 91.6% | 824.726 | 0.00e+00 | 99.0% |
101 | KJ874990 | Comactinia echinoptera voucher UF:6292 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 91.6% | 824.726 | 0.00e+00 | 99.0% |
102 | OP546034 | Capillaster sp. DH-Y2 mitochondrion, complete genome | 593 | 91.6% | 819.186 | 0.00e+00 | 98.5% |
103 | KR010324 | Capillaster multiradiatus voucher UF:UF10621 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 593 | 91.6% | 819.186 | 0.00e+00 | 98.5% |
104 | KR010326 | Capillaster multiradiatus voucher LIPI spm C373 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 548 | 91.6% | 758.247 | 0.00e+00 | 91.0% |
105 | KR010340 | Comaster schlegelii voucher SIO:BIC:spm 358 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 547 | 91.6% | 756.4 | 0.00e+00 | 90.9% |
106 | KJ874998 | Comanthus sp. 2 MS-2014 voucher MNHN:IE-2013-8034 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.5% | 828.419 | 0.00e+00 | 99.8% |
107 | KR010240 | Clarkcomanthus albinotus voucher SIO:BIC:E6187 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.5% | 828.419 | 0.00e+00 | 99.8% |
108 | KR010321 | Capillaster multiradiatus voucher DNA spm RA193 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.5% | 828.419 | 0.00e+00 | 99.8% |
109 | KR010241 | Clarkcomanthus albinotus voucher SIO:BIC:E6188 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.5% | 828.419 | 0.00e+00 | 99.8% |
110 | OP897996 | Comanthus wahlbergii voucher AB49103152 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 565 | 91.5% | 778.56 | 0.00e+00 | 93.9% |
111 | OP897989 | Comanthus wahlbergii voucher AB49103176 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 565 | 91.5% | 778.56 | 0.00e+00 | 93.9% |
112 | OP897988 | Comanthus wahlbergii voucher AB49103186 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 91.5% | 763.787 | 0.00e+00 | 92.0% |
113 | KR010309 | Capillaster sentosus voucher LIPI spm 368 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 541 | 91.5% | 745.32 | 0.00e+00 | 89.9% |
114 | KR010314 | Capillaster multiradiatus voucher MNHN:IE-2013-8163 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 91.4% | 824.726 | 0.00e+00 | 100.0% |
115 | KR010211 | Clarkcomanthus littoralis voucher SIO:BIC:spm C361 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 91.4% | 824.726 | 0.00e+00 | 100.0% |
116 | KR010212 | Clarkcomanthus littoralis voucher SAM602 |
91.4% |
824.726 |
0.00e+00 |
100.0% |
|
117 | KJ874982 | Capillaster multiradiatus voucher SAMA:K2009 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 91.4% | 824.726 | 0.00e+00 | 100.0% |
118 | KR010216 | Clarkcomanthus littoralis voucher MNHN:IE-2013-8182 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 91.4% | 824.726 | 0.00e+00 | 100.0% |
119 | KR010215 | Clarkcomanthus littoralis voucher MNHN:IE-2013-8132 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 91.4% | 824.726 | 0.00e+00 | 100.0% |
120 | KJ874993 | Clarkcomanthus alternans voucher MNHN:IE-2013-8173 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.3% | 822.879 | 0.00e+00 | 99.8% |
121 | KR010332 | Comaster audax voucher MNHN:IE-2013-8130 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.3% | 822.879 | 0.00e+00 | 99.8% |
122 | KJ875002 | Comaster audax voucher MNHN:IE-2013-8140 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.3% | 822.879 | 0.00e+00 | 99.8% |
123 | KJ874984 | Capillaster multiradiatus voucher MNHN:IE-2013-8029 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.3% | 822.879 | 0.00e+00 | 99.8% |
124 | KR010230 | Clarkcomanthus albinotus voucher SIO:BIC:E5943 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.3% | 822.879 | 0.00e+00 | 99.8% |
125 | KR010233 | Clarkcomanthus albinotus voucher MNHN:IE-2013-8068 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.3% | 822.879 | 0.00e+00 | 99.8% |
126 | KR010199 | Clarkcomanthus alternans voucher UF:UF10623 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.3% | 822.879 | 0.00e+00 | 99.8% |
127 | KR010204 | Clarkcomanthus alternans voucher MNHN:IE-2013-8164 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.3% | 822.879 | 0.00e+00 | 99.8% |
128 | KR010203 | Clarkcomanthus alternans voucher MNHN:IE-2013-8180 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.3% | 822.879 | 0.00e+00 | 99.8% |
129 | KR010313 | Capillaster multiradiatus voucher UF:UF7547 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 91.2% | 819.186 | 0.00e+00 | 100.0% |
130 | KR010208 | Clarkcomanthus comanthipinnus voucher SIO:BIC:E6073 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 91.2% | 819.186 | 0.00e+00 | 100.0% |
131 | KR010318 | Capillaster multiradiatus voucher UF:UF10632 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 91.2% | 819.186 | 0.00e+00 | 100.0% |
132 | KR010217 | Clarkcomanthus littoralis voucher SIO:BIC:E6193 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 91.2% | 819.186 | 0.00e+00 | 100.0% |
133 | KR010315 | Capillaster multiradiatus voucher MNHN:IE-2013-8165 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 91.2% | 819.186 | 0.00e+00 | 100.0% |
134 | KR010191 | Clarkcomanthus mirabilis voucher AM:J25411 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.2% | 817.339 | 0.00e+00 | 99.8% |
135 | KR010320 | Capillaster multiradiatus voucher AM:J25422 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.2% | 817.339 | 0.00e+00 | 99.8% |
136 | KR010336 | Comaster audax voucher SAM601 |
91.2% |
817.339 |
0.00e+00 |
99.8% |
|
137 | KR010229 | Clarkcomanthus albinotus voucher AM:J25413 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.2% | 817.339 | 0.00e+00 | 99.8% |
138 | KR010202 | Clarkcomanthus alternans voucher MNHN:IE-2013-8168 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.2% | 817.339 | 0.00e+00 | 99.8% |
139 | KJ875018 | Phanogenia gracilis voucher SIO:BIC:E5877 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.2% | 817.339 | 0.00e+00 | 99.8% |
140 | OM841883 | Comanthus briareus voucher CB1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 91.2% | 817.339 | 0.00e+00 | 99.8% |
141 | KM491779 | Clarkcomanthus alternans voucher SIO:BIC:E6161 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.2% | 817.339 | 0.00e+00 | 99.8% |
142 | GQ913327 | Clarkcomanthus littoralis cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.2% | 817.339 | 0.00e+00 | 99.8% |
143 | OP897993 | Comanthus wahlbergii voucher AB49103157 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 91.2% | 815.493 | 0.00e+00 | 99.7% |
144 | KR010220 | Clarkcomanthus littoralis voucher SIO:BIC:E6195 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 568 | 91.2% | 773.02 | 0.00e+00 | 94.4% |
145 | OP897994 | Comanthus wahlbergii voucher AB49103156 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 566 | 91.2% | 769.327 | 0.00e+00 | 94.0% |
146 | OP897992 | Comanthus wahlbergii voucher AB49103170 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 566 | 91.2% | 769.327 | 0.00e+00 | 94.0% |
147 | OP897997 | Comanthus wahlbergii voucher AB49103151 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 565 | 91.2% | 767.48 | 0.00e+00 | 93.9% |
148 | OP897995 | Comanthus wahlbergii voucher AB49103153 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 565 | 91.2% | 767.48 | 0.00e+00 | 93.9% |
149 | OP897986 | Comanthus wahlbergii voucher AB49142204 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 558 | 91.2% | 761.94 | 0.00e+00 | 92.7% |
150 | KR010219 | Clarkcomanthus littoralis voucher DNA spm RA559 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 556 | 91.2% | 756.4 | 0.00e+00 | 92.4% |
151 | KM491778 | Comactinia titan voucher SIO:BIC:E6159 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 91.1% | 808.106 | 0.00e+00 | 99.0% |
152 | KR010256 | Comanthus wahlbergii voucher SIO:BIC:E6253 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 538 | 91.1% | 728.7 | 0.00e+00 | 89.4% |
153 | GU327859 | Oxycomanthus exilis cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.0% | 813.646 | 0.00e+00 | 99.8% |
154 | KR010210 | Clarkcomanthus comanthipinnus voucher MNHN:IE-2013-8171 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 91.0% | 813.646 | 0.00e+00 | 100.0% |
155 | KR010319 | Capillaster multiradiatus voucher SIO:BIC:E6178 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 91.0% | 813.646 | 0.00e+00 | 100.0% |
156 | KR010206 | Clarkcomanthus comanthipinnus voucher MNHN:IE-2013-8081 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 91.0% | 813.646 | 0.00e+00 | 100.0% |
157 | GQ913318 | Oxycomanthus comanthipinna cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 91.0% | 813.646 | 0.00e+00 | 100.0% |
158 | KR010209 | Clarkcomanthus comanthipinnus voucher MNHN:IE-2013-8151 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 91.0% | 813.646 | 0.00e+00 | 100.0% |
159 | GQ913312 | Clarkcomanthus albinotus cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.0% | 811.799 | 0.00e+00 | 99.8% |
160 | KR010296 | Phanogenia gracilis voucher SIO:BIC:E6303 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.0% | 811.799 | 0.00e+00 | 99.8% |
161 | GU327857 | Comanthus wahlbergii cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.0% | 811.799 | 0.00e+00 | 99.8% |
162 | KR010228 | Clarkcomanthus albinotus voucher DNA spm C180 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.0% | 811.799 | 0.00e+00 | 99.8% |
163 | KR010333 | Comaster audax voucher AM:J25410 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.0% | 811.799 | 0.00e+00 | 99.8% |
164 | KR010231 | Clarkcomanthus albinotus voucher MNHN:IE-2013-8122 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.0% | 811.799 | 0.00e+00 | 99.8% |
165 | KR010192 | Clarkcomanthus mirabilis voucher AM:J25421 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 91.0% | 811.799 | 0.00e+00 | 99.8% |
166 | OP897985 | Comanthus wahlbergii voucher AB49103145 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 91.0% | 809.953 | 0.00e+00 | 99.7% |
167 | KR010226 | Clarkcomanthus luteofuscum voucher SIO:BIC:E5953 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 90.9% | 808.106 | 0.00e+00 | 100.0% |
168 | KR010258 | Comanthus wahlbergii voucher MNHN:IE-2013-8020 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 90.8% | 806.26 | 0.00e+00 | 99.8% |
169 | KM491774 | Clarkcomanthus mirabilis voucher MNHN:IE-2013-8174 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 90.8% | 806.26 | 0.00e+00 | 99.8% |
170 | GQ913313 | Comanthus mirabilis cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 90.8% | 806.26 | 0.00e+00 | 99.8% |
171 | KR010257 | Comanthus wahlbergii voucher SIO:BIC:E6251 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 90.8% | 806.26 | 0.00e+00 | 99.8% |
172 | KR010193 | Clarkcomanthus mirabilis voucher MNHN:IE-2013-8174 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 90.8% | 806.26 | 0.00e+00 | 99.8% |
173 | KR010194 | Clarkcomanthus mirabilis voucher MNHN:IE-2013-8111 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 90.8% | 806.26 | 0.00e+00 | 99.8% |
174 | KR010259 | Comanthus wahlbergii voucher MNHN:IE-2013-8042 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 90.8% | 806.26 | 0.00e+00 | 99.8% |
175 | NC_059908 | Anneissia intermedia mitochondrion, complete genome | 602 | 90.7% | 802.566 | 0.00e+00 | 100.0% |
176 | KJ874989 | Clarkcomanthus luteofuscum voucher SAMA:K1970 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 90.7% | 802.566 | 0.00e+00 | 100.0% |
177 | KM491782 | Clarkcomanthus luteofuscum voucher SIO:BIC:E5951 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 90.7% | 802.566 | 0.00e+00 | 100.0% |
178 | KR010223 | Clarkcomanthus luteofuscum voucher SIO:BIC:E6205 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 90.7% | 802.566 | 0.00e+00 | 100.0% |
179 | KM491773 | Clarkcomanthus alternans voucher MNHN:IE-2013-8114 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 90.7% | 800.72 | 0.00e+00 | 99.8% |
180 | KR010232 | Clarkcomanthus albinotus voucher MNHN:IE-2013-8060 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 90.7% | 800.72 | 0.00e+00 | 99.8% |
181 | KR010198 | Clarkcomanthus alternans voucher MNHN:IE-2013-8114 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 90.7% | 800.72 | 0.00e+00 | 99.8% |
182 | KJ874987 | Clarkcomanthus albinotus voucher SIO:BIC:E5869 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 559 | 90.7% | 745.32 | 0.00e+00 | 92.9% |
183 | KJ874992 | Comactinia titan voucher MNHN:EcCh185 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 548 | 90.7% | 730.547 | 0.00e+00 | 91.0% |
184 | KR010334 | Comaster audax voucher DNA spm RA619 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 544 | 90.6% | 723.16 | 0.00e+00 | 90.4% |
185 | KR010227 | Clarkcomanthus luteofuscum voucher SIO:BIC:E6198 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 90.5% | 797.026 | 0.00e+00 | 100.0% |
186 | KR010335 | Comaster audax voucher SIO:BIC:E6256 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 90.5% | 795.18 | 0.00e+00 | 99.8% |
187 | KR010260 | Comanthus wahlbergii voucher MNHN:IE-2013-8098 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 90.5% | 795.18 | 0.00e+00 | 99.8% |
188 | KR010316 | Capillaster multiradiatus voucher SIO:BIC:E5899 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 90.4% | 791.486 | 0.00e+00 | 100.0% |
189 | KJ875013 | Davidaster rubiginosus voucher SIO:BIC:E4715 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 90.4% | 789.64 | 0.00e+00 | 99.8% |
190 | NC_069630 | Tropiometra macrodiscus mitochondrion, complete genome | 601 | 90.3% | 789.64 | 0.00e+00 | 99.8% |
191 | KJ875012 | Davidaster discoideus voucher SIO:BIC:E4714 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 90.3% | 789.64 | 0.00e+00 | 99.8% |
192 | KJ874986 | Cenolia tasmaniae voucher SIO:BIC:E5874 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 90.2% | 784.1 | 0.00e+00 | 99.8% |
193 | OP898281 | Tropiometra carinata voucher AB42609997 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 558 | 90.2% | 726.854 | 0.00e+00 | 92.7% |
194 | OP898275 | Tropiometra carinata voucher AB42609900 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 558 | 90.2% | 726.854 | 0.00e+00 | 92.7% |
195 | OP898274 | Tropiometra carinata voucher AB49103143 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 558 | 90.2% | 726.854 | 0.00e+00 | 92.7% |
196 | OP898285 | Tropiometra carinata voucher AB49142201 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 558 | 90.2% | 726.854 | 0.00e+00 | 92.7% |
197 | OP898255 | Tropiometra carinata voucher AB49142180 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 596 | 90.1% | 774.866 | 0.00e+00 | 99.0% |
198 | OP898286 | Tropiometra carinata voucher AB42609717 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 596 | 90.1% | 774.866 | 0.00e+00 | 99.0% |
199 | OP898280 | Tropiometra carinata voucher AB42609962 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 90.0% | 778.56 | 0.00e+00 | 99.7% |
200 | KR010190 | Clarkcomanthus mirus voucher SAM601 |
90.0% |
778.56 |
0.00e+00 |
99.8% |
|
201 | KJ875016 | Clarkcomanthus mirus voucher SAMA:K2016 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 90.0% | 778.56 | 0.00e+00 | 99.8% |
202 | OP898276 | Tropiometra carinata voucher AB42609871 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 90.0% | 776.713 | 0.00e+00 | 99.7% |
203 | OP898277 | Tropiometra carinata voucher AB42608957 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 90.0% | 776.713 | 0.00e+00 | 99.7% |
204 | OP898257 | Tropiometra carinata voucher AB49142182 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 90.0% | 776.713 | 0.00e+00 | 99.7% |
205 | OP898266 | Tropiometra carinata voucher AB42609894 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 90.0% | 776.713 | 0.00e+00 | 99.7% |
206 | OP898269 | Tropiometra carinata voucher AB49103159 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 90.0% | 776.713 | 0.00e+00 | 99.7% |
207 | OP898278 | Tropiometra carinata voucher AB42609991 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 90.0% | 776.713 | 0.00e+00 | 99.7% |
208 | OP898284 | Tropiometra carinata voucher AB49142172 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 90.0% | 776.713 | 0.00e+00 | 99.7% |
209 | OP898270 | Tropiometra carinata voucher AB49142206 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 90.0% | 776.713 | 0.00e+00 | 99.7% |
210 | OP898258 | Tropiometra carinata voucher AB49142203 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 90.0% | 776.713 | 0.00e+00 | 99.7% |
211 | OP898259 | Tropiometra carinata voucher AB49142184 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 90.0% | 776.713 | 0.00e+00 | 99.7% |
212 | OP898265 | Tropiometra carinata voucher AB42609741 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 90.0% | 776.713 | 0.00e+00 | 99.7% |
213 | OP898271 | Tropiometra carinata voucher AB49142190 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 90.0% | 776.713 | 0.00e+00 | 99.7% |
214 | OP898283 | Tropiometra carinata voucher AB42608963 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 90.0% | 776.713 | 0.00e+00 | 99.7% |
215 | OP898256 | Tropiometra carinata voucher AB49142181 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 589 | 90.0% | 761.94 | 0.00e+00 | 97.8% |
216 | LC580406 | Capillaster multiradiatus TT65 mitochondrial COX1 gene for cytochrome c oxidase subunit 1, partial cds | 582 | 90.0% | 754.553 | 0.00e+00 | 96.7% |
217 | OP898279 | Tropiometra carinata voucher AB42609479 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 89.9% | 773.02 | 0.00e+00 | 99.7% |
218 | KR010328 | Capillaster multiradiatus voucher LIPI spm 371 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 89.9% | 773.02 | 0.00e+00 | 99.8% |
219 | KR010323 | Capillaster multiradiatus voucher SS-0391 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 89.9% | 773.02 | 0.00e+00 | 99.8% |
220 | GU327867 | Tropiometra afra cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 89.9% | 773.02 | 0.00e+00 | 99.8% |
221 | OP898263 | Tropiometra carinata voucher AB49103169 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 89.9% | 771.173 | 0.00e+00 | 99.7% |
222 | OP898272 | Tropiometra carinata voucher AB49103149 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 566 | 89.9% | 730.547 | 0.00e+00 | 94.0% |
223 | OP898273 | Tropiometra carinata voucher AB49142205 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 566 | 89.9% | 730.547 | 0.00e+00 | 94.0% |
224 | OP898282 | Tropiometra carinata voucher AB42608951 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 565 | 89.9% | 728.7 | 0.00e+00 | 93.9% |
225 | OP898288 | Tropiometra carinata voucher AB49142202 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 565 | 89.9% | 728.7 | 0.00e+00 | 93.9% |
226 | OP898267 | Tropiometra carinata voucher AB49103165 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 565 | 89.9% | 728.7 | 0.00e+00 | 93.9% |
227 | KJ875010 | Comatula rotalaria voucher SAMA:K2048 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 89.7% | 767.48 | 0.00e+00 | 99.8% |
228 | KR010322 | Capillaster multiradiatus voucher SS-3660 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 89.7% | 767.48 | 0.00e+00 | 99.8% |
229 | OP898268 | Tropiometra carinata voucher AB49103163 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 545 | 89.7% | 697.307 | 0.00e+00 | 90.5% |
230 | OP546035 | Ptilometra sp. DH-R mitochondrion, complete genome | 602 | 89.5% | 763.787 | 0.00e+00 | 100.0% |
231 | MW385387 | Decametra sp. RMS-2541 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 89.5% | 761.94 | 0.00e+00 | 99.8% |
232 | KR010348 | Comatula rotalaria voucher DNA spm C320 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 89.4% | 756.4 | 0.00e+00 | 99.8% |
233 | GU327851 | Cenometra bella cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 599 | 89.3% | 752.707 | 0.00e+00 | 99.5% |
234 | KR010329 | Capillaster multiradiatus voucher LIPI spm 366 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 562 | 89.3% | 706.54 | 0.00e+00 | 93.4% |
235 | MW385388 | Heterometra africana voucher Heterometra_africana-FMNH-13644 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 89.2% | 750.86 | 0.00e+00 | 99.8% |
236 | MW385397 | Oligometra serripinna voucher Oligometra_serripinna-SIO-E6887 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 89.2% | 750.86 | 0.00e+00 | 99.8% |
237 | MW385382 | Cenometra herdmani voucher Cenometra_herdmani-MNHN-342 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 89.2% | 750.86 | 0.00e+00 | 99.8% |
238 | OP897981 | Cenometra emendatrix voucher AB42610003 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 89.2% | 749.013 | 0.00e+00 | 99.7% |
239 | OP897978 | Cenometra emendatrix voucher AB42610200 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 89.2% | 749.013 | 0.00e+00 | 99.7% |
240 | OP898135 | Oligometra serripinna voucher AB49103189 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 557 | 89.2% | 697.307 | 0.00e+00 | 92.5% |
241 | OP898146 | Oligometra serripinna voucher AB49142210 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 557 | 89.2% | 697.307 | 0.00e+00 | 92.5% |
242 | MW553876 | Heterometra schlegelii voucher TR0657bi cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 89.1% | 745.32 | 0.00e+00 | 99.8% |
243 | MW385381 | Cenometra bella voucher Cenometra_bella-RMS-3649 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 89.0% | 745.32 | 0.00e+00 | 99.8% |
244 | KJ875008 | Comatula sp. n. MS-2014 voucher SIO:BIC:E5870 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 89.0% | 745.32 | 0.00e+00 | 99.8% |
245 | GU327849 | Chondrometra sp. GWR-2010 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 89.0% | 745.32 | 0.00e+00 | 99.8% |
246 | OP898130 | Oligometra serripinna voucher AB49103158 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 89.0% | 743.473 | 0.00e+00 | 99.7% |
247 | OP898129 | Oligometra serripinna voucher AB49103155 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 89.0% | 743.473 | 0.00e+00 | 99.7% |
248 | OP898141 | Oligometra serripinna voucher AB49142189 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 89.0% | 743.473 | 0.00e+00 | 99.7% |
249 | OP898144 | Oligometra serripinna voucher AB49142195 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 89.0% | 743.473 | 0.00e+00 | 99.7% |
250 | OP898128 | Oligometra serripinna voucher AB49103147 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 89.0% | 743.473 | 0.00e+00 | 99.7% |
251 | KR010293 | Comatella nigra voucher DNA spm RA613 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 89.0% | 736.087 | 0.00e+00 | 99.0% |
252 | MW553877 | Heterometra schlegelii voucher TR2145 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
253 | KM014352 | Oligometra serripinna voucher MNHN:IE-2013-8101 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
254 | MW553885 | Heterometra schlegelii voucher TR2150a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
255 | MW553905 | Heterometra schlegelii voucher TR2162 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
256 | MW553879 | Heterometra schlegelii voucher TR2136i cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
257 | MW553896 | Heterometra schlegelii voucher TR0730 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
258 | MW553904 | Heterometra schlegelii voucher TR2161 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
259 | KM014346 | Basilometra boschmai voucher SIO:BIC:E6072 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
260 | MW553886 | Heterometra schlegelii voucher TR2147b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
261 | MW553891 | Heterometra schlegelii voucher TR0326ai cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
262 | MW553906 | Heterometra schlegelii voucher TR2164ii cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
263 | MW553878 | Heterometra schlegelii voucher TR2139 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
264 | MW553884 | Heterometra schlegelii voucher TR0982 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
265 | MW553898 | Heterometra schlegelii voucher TR2148ai cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
266 | MW553902 | Heterometra schlegelii voucher TR2146 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
267 | MW553882 | Heterometra schlegelii voucher TR0326aii cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
268 | MW385386 | Decametra arabica voucher Decametra_arabica-MNHN-3654 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
269 | KM491787 | Cenometra bella voucher MNHN:IE-2013-8070 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
270 | MW553887 | Heterometra schlegelii voucher TR0985 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
271 | MW553880 | Heterometra schlegelii voucher TR0971 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
272 | MW553893 | Heterometra schlegelii voucher TR2136ii cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
273 | MW385393 | Heterometra schlegelii voucher Heterometra_schlegelii-RMS-3646 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
274 | MW553889 | Heterometra schlegelii voucher TR0320i cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
275 | MW553881 | Heterometra schlegelii voucher TR0324i cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
276 | MW553892 | Heterometra schlegelii voucher TR2135 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
277 | MW553899 | Heterometra schlegelii voucher TR2154ii cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
278 | MW553894 | Heterometra schlegelii voucher TR2152 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
279 | MW553903 | Heterometra schlegelii voucher TR2154i cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
280 | MW553883 | Heterometra schlegelii voucher TR0328i cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
281 | MW385392 | Heterometra savignii voucher Heterometra_savignii-RMS-2525 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
282 | MW553890 | Heterometra schlegelii voucher TR0320ii cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
283 | MW553900 | Heterometra schlegelii voucher TR0328ii cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
284 | MW553895 | Heterometra schlegelii voucher TR2164i cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
285 | MW553901 | Heterometra schlegelii voucher TR0657bii cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
286 | MW553897 | Heterometra schlegelii voucher TR2144ii cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
287 | MW553888 | Heterometra schlegelii voucher TR0318aii cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.9% | 739.78 | 0.00e+00 | 99.8% |
288 | KJ875009 | Comatula pectinata voucher SAMA:K2263 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 88.7% | 734.24 | 0.00e+00 | 99.8% |
289 | KM491772 | Cenometra bella voucher AM:J.25425 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 88.7% | 734.24 | 0.00e+00 | 99.8% |
290 | MW385403 | Pontiometra andersoni voucher Pontiometra_andersoni-SIO-E6072 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.7% | 734.24 | 0.00e+00 | 99.8% |
291 | MW553875 | Heterometra schlegelii voucher TR2148aii cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.7% | 734.24 | 0.00e+00 | 99.8% |
292 | NC_061054 | Cenometra bella isolate HS0179 voucher LKCNHM:ZRC.ECH.1687 mitochondrion, complete genome | 601 | 88.7% | 734.24 | 0.00e+00 | 99.8% |
293 | KR010284 | Comatella nigra voucher MNHN:IE-2013-8135 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 88.7% | 725.007 | 0.00e+00 | 99.0% |
294 | KR010288 | Comatella nigra voucher MNHN:IE-2013-8175 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 88.6% | 728.7 | 0.00e+00 | 99.8% |
295 | KR010280 | Comatella stelligera voucher SIO:BIC:E6267 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 88.6% | 725.007 | 0.00e+00 | 99.0% |
296 | KR010349 | Comatula solaris voucher SAM596 |
88.6% |
725.007 |
0.00e+00 |
99.0% |
|
297 | MT264527 | Promachocrinus sp. un ELM-2023 voucher WAM:Z44803 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.5% | 730.547 | 0.00e+00 | 100.0% |
298 | MW385380 | Basilometra boschmai voucher Basilometra_boschmai-SIO-E6072 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.5% | 728.7 | 0.00e+00 | 99.8% |
299 | MW385402 | Pontiometra andersoni voucher Pontiometra_andersoni-NSU-417 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.5% | 728.7 | 0.00e+00 | 99.8% |
300 | GU327850 | Crinometra brevipinna cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 88.5% | 728.7 | 0.00e+00 | 99.8% |
301 | MW385379 | Basilometra boschmai voucher Basilometra_boschmai-NSU-223 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.5% | 728.7 | 0.00e+00 | 99.8% |
302 | KR010281 | Comatella stelligera voucher SIO:BIC:E6268 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 88.5% | 719.467 | 0.00e+00 | 99.0% |
303 | KR010279 | Comatella stelligera voucher MNHN:IE-2013-8061 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 88.5% | 719.467 | 0.00e+00 | 99.0% |
304 | KJ875007 | Comatella stelligera voucher UF:3868 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 88.5% | 719.467 | 0.00e+00 | 99.0% |
305 | NC_068252 | Comatella stelligera mitochondrion, complete genome | 596 | 88.5% | 719.467 | 0.00e+00 | 99.0% |
306 | MT264456 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E4970 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.4% | 725.007 | 0.00e+00 | 100.0% |
307 | MT264460 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E4955 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.4% | 725.007 | 0.00e+00 | 100.0% |
308 | MT264526 | Promachocrinus sp. un ELM-2023 voucher SIO:BIC:E4454 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.4% | 725.007 | 0.00e+00 | 100.0% |
309 | MT264724 | Promachocrinus sp. un ELM-2023 voucher SIO:BIC:E11336 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.4% | 725.007 | 0.00e+00 | 100.0% |
310 | MT264493 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E5498L cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.4% | 725.007 | 0.00e+00 | 100.0% |
311 | GU327861 | Stephanometra indica voucher SAM K1995 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 88.4% | 723.16 | 0.00e+00 | 99.8% |
312 | MN883538 | Florometra sp. BMK-2020 mitochondrion, complete genome | 601 | 88.4% | 723.16 | 0.00e+00 | 99.8% |
313 | KR010283 | Comatella nigra voucher SAM596 |
88.3% |
713.927 |
0.00e+00 |
99.0% |
|
314 | KR010287 | Comatella nigra voucher SIO:BIC:E5888 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 88.3% | 713.927 | 0.00e+00 | 99.0% |
315 | KR010286 | Comatella nigra voucher MNHN:IE-2013-8118 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 88.3% | 713.927 | 0.00e+00 | 99.0% |
316 | NC_068254 | Comatella nigra mitochondrion, complete genome | 596 | 88.3% | 713.927 | 0.00e+00 | 99.0% |
317 | KJ875011 | Comatula solaris voucher SAMA:K2058 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 88.3% | 713.927 | 0.00e+00 | 99.0% |
318 | DQ186656 | Notocrinus virilis voucher C160475 cytochrome oxidase subunit 1 (CO1) gene, partial cds; mitochondrial | 596 | 88.3% | 713.927 | 0.00e+00 | 99.0% |
319 | KR010290 | Comatella nigra voucher MNHN:IE-2013-8110 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 88.3% | 713.927 | 0.00e+00 | 99.0% |
320 | MT264448 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11337 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
321 | MT264718 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11278 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
322 | MT264437 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E5002 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
323 | MT264472 | Promachocrinus sp. f ELM-2023 voucher WAM:Z44787 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
324 | MT264417 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E4592 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
325 | MT264453 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11343 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
326 | MT264433 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11299 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
327 | MT264439 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E4821 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
328 | MT264414 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E4589 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
329 | MT264409 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E5625F cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
330 | MT264442 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11329 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
331 | MT264559 | Promachocrinus sp. f ELM-2023 voucher AAD-148 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
332 | MT264445 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11332 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
333 | MT264499 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E5498R cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
334 | MT264507 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11223_10 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
335 | MT264435 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11301 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
336 | MT264550 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11333 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
337 | MT264466 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11361 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
338 | MT264506 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E5498Y cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
339 | MT264454 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E4850 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
340 | MT264557 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11338 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
341 | MT264425 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11281 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
342 | MT264494 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E5498M cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
343 | MT264481 | Promachocrinus sp. f ELM-2023 voucher WAM:Z44727 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
344 | MT264401 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E4436 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
345 | MT264457 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11305 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
346 | MT264408 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E5625E cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
347 | MT264429 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11286 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
348 | MT264407 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E5625D cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
349 | MT264487 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E5498F cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
350 | MT264434 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11300 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
351 | MT264707 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11275 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
352 | MT264517 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11223_21 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
353 | MT264441 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E4994 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
354 | MT264444 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11331 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
355 | MT264447 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11335 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
356 | MT264515 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11223_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
357 | MT264423 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11274 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
358 | MT264705 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E4830 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
359 | MT264404 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E4434 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
360 | MT264723 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11277 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
361 | MT264548 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E4824 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
362 | MT264467 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11363 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
363 | MT264432 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11297 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
364 | MT264495 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E5498N cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
365 | MT264522 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11223_27 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
366 | MT264424 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11276 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
367 | MT264478 | Promachocrinus sp. f ELM-2023 voucher WAM:Z44723 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
368 | MT264406 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E5625C cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
369 | MT264451 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11341 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
370 | MT264426 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11282 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
371 | MT264402 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E4475 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
372 | MT264440 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E4951 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
373 | MT264438 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E4953 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.2% | 719.467 | 0.00e+00 | 100.0% |
374 | MW385383 | Clarkometra elegans voucher Clarkometra_elegans-NSMT-E5224 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.2% | 717.62 | 0.00e+00 | 99.8% |
375 | MW405444 | Oligometra serripinna mitochondrion, complete genome | 601 | 88.2% | 717.62 | 0.00e+00 | 99.8% |
376 | MW385390 | Heterometra sarae voucher Heterometra_sarae-OMNH-E5371 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.2% | 717.62 | 0.00e+00 | 99.8% |
377 | MW385391 | Heterometra sarae voucher Heterometra_sarae-OMNH-E5372 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.2% | 717.62 | 0.00e+00 | 99.8% |
378 | GQ913320 | Stephanometra indica cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 88.2% | 717.62 | 0.00e+00 | 99.8% |
379 | KR046224 | Comatula pectinata voucher SAM601 |
88.2% |
717.62 |
0.00e+00 |
99.8% |
|
380 | KJ875006 | Comatella nigra voucher SIO:BIC:E5875 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 88.2% | 708.387 | 0.00e+00 | 99.0% |
381 | KJ875005 | Comatella nigra voucher SAMA:K2088 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 593 | 88.2% | 708.387 | 0.00e+00 | 98.5% |
382 | PP735416 | Cenometra bella isolate CB5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 599 | 88.1% | 713.927 | 0.00e+00 | 99.5% |
383 | MW376013 | Dichrometra flagellata voucher RMS-2367 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial. | 601 | 88.1% | 712.08 | 0.00e+00 | 99.8% |
384 | MW367658 | Himerometra robustipinna voucher H_robustipinna-SAM-K2021 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 88.1% | 712.08 | 0.00e+00 | 99.8% |
385 | KR010282 | Comatella nigra voucher DNA spm C200 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 593 | 88.1% | 702.847 | 0.00e+00 | 98.5% |
386 | MT264469 | Promachocrinus sp. f ELM-2023 voucher WAM:Z44383 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.0% | 713.927 | 0.00e+00 | 100.0% |
387 | MT264486 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E5498E cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.0% | 713.927 | 0.00e+00 | 100.0% |
388 | MT264397 | Promachocrinus sp. f ELM-2023 voucher WAM:Z44775 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.0% | 713.927 | 0.00e+00 | 100.0% |
389 | MT264554 | Promachocrinus sp. f ELM-2023 voucher AAD-147 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.0% | 713.927 | 0.00e+00 | 100.0% |
390 | MT264413 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E4586 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.0% | 713.927 | 0.00e+00 | 100.0% |
391 | MT264412 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E4584 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.0% | 713.927 | 0.00e+00 | 100.0% |
392 | MT264715 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E4856 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.0% | 713.927 | 0.00e+00 | 100.0% |
393 | MT264452 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11342 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.0% | 713.927 | 0.00e+00 | 100.0% |
394 | MT264431 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11294 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.0% | 713.927 | 0.00e+00 | 100.0% |
395 | MT264405 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E5625B cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.0% | 713.927 | 0.00e+00 | 100.0% |
396 | MT264503 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E5498V cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.0% | 713.927 | 0.00e+00 | 100.0% |
397 | MT264462 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11304 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.0% | 713.927 | 0.00e+00 | 100.0% |
398 | MT264427 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11284 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.0% | 713.927 | 0.00e+00 | 100.0% |
399 | MT264475 | Promachocrinus sp. f ELM-2023 voucher WAM:Z44796 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.0% | 713.927 | 0.00e+00 | 100.0% |
400 | MT264519 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11223_24 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.0% | 713.927 | 0.00e+00 | 100.0% |
401 | MT264546 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E4873 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 88.0% | 713.927 | 0.00e+00 | 100.0% |
402 | MT302206 | Florometra sp. BMK-2020 mitochondrion, complete genome | 601 | 88.0% | 712.08 | 0.00e+00 | 99.8% |
403 | KM491775 | Comatella nigra voucher MNHN:IE-2013-8064 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 88.0% | 702.847 | 0.00e+00 | 99.0% |
404 | KR010285 | Comatella nigra voucher MNHN:IE-2013-8136 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 88.0% | 702.847 | 0.00e+00 | 99.0% |
405 | KR010291 | Comatella nigra voucher MNHN:IE-2013-8121 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 88.0% | 702.847 | 0.00e+00 | 99.0% |
406 | KR010289 | Comatella nigra voucher MNHN:IE-2013-8064 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 88.0% | 702.847 | 0.00e+00 | 99.0% |
407 | MT264501 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E5498T cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.9% | 708.387 | 0.00e+00 | 100.0% |
408 | MT264396 | Promachocrinus sp. f ELM-2023 voucher WAM:Z44337 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.9% | 708.387 | 0.00e+00 | 100.0% |
409 | MT264395 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E4867 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.9% | 708.387 | 0.00e+00 | 100.0% |
410 | MT264399 | Promachocrinus sp. f ELM-2023 voucher WAM:Z44778 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.9% | 708.387 | 0.00e+00 | 100.0% |
411 | MT264722 | Promachocrinus sp. f ELM-2023 voucher SIO:BIC:E11273 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.9% | 708.387 | 0.00e+00 | 100.0% |
412 | MW385405 | Stephanometra tenuipinna voucher Stephanometra_tenuipinna-SIO-E5842 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.9% | 706.54 | 0.00e+00 | 99.8% |
413 | AY669365 | Notocrinus virilis isolate Nv1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 87.9% | 706.54 | 0.00e+00 | 99.0% |
414 | MW385398 | Oxymetra finschii voucher Oxymetra_finschii-SIO-E5852 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.9% | 706.54 | 0.00e+00 | 99.8% |
415 | MW367665 | Himerometra robustipinna voucher H_robustipinna-FMNH-8122 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.9% | 706.54 | 0.00e+00 | 99.8% |
416 | MT264538 | Promachocrinus sp. us ELM-2023 voucher SIO:BIC:E4477 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.9% | 706.54 | 0.00e+00 | 99.8% |
417 | MT264693 | Promachocrinus sp. w ELM-2023 voucher WAM:Z44016 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.9% | 706.54 | 0.00e+00 | 99.8% |
418 | KR046225 | Comatula pectinata voucher SAM601 |
87.9% |
706.54 |
0.00e+00 |
99.8% |
|
419 | MW385378 | Analcidometra armata voucher Analcidometra_armata-HBOM-70-00047 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.9% | 706.54 | 0.00e+00 | 99.8% |
420 | MW385404 | Stephanometra indica voucher Stephanometra_indica-SIO-E5845 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.9% | 706.54 | 0.00e+00 | 99.8% |
421 | MT264694 | Promachocrinus sp. w ELM-2023 voucher WAM:Z44907 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.9% | 706.54 | 0.00e+00 | 99.8% |
422 | MT264692 | Promachocrinus sp. w ELM-2023 voucher WAM:Z44000 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.9% | 706.54 | 0.00e+00 | 99.8% |
423 | GU327866 | Ptilometra macronema cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 87.9% | 706.54 | 0.00e+00 | 99.8% |
424 | MW385395 | Himerometra robustipinna voucher Himerometra_bartschi-NSMT-E5171b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.9% | 706.54 | 0.00e+00 | 99.8% |
425 | MW385394 | Himerometra robustipinna voucher Himerometra_bartschi-NSMT-E5171a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.9% | 706.54 | 0.00e+00 | 99.8% |
426 | MT264131 | Promachocrinus kerguelensis voucher SIO:BIC:E11247 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 597 | 87.9% | 704.694 | 0.00e+00 | 99.2% |
427 | MT264218 | Promachocrinus kerguelensis voucher SIO:BIC:E4823 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 597 | 87.9% | 704.694 | 0.00e+00 | 99.2% |
428 | MT264721 | Promachocrinus kerguelensis voucher SIO:BIC:E4911 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 597 | 87.9% | 704.694 | 0.00e+00 | 99.2% |
429 | MT264236 | Promachocrinus kerguelensis voucher SIO:BIC:E11369 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 597 | 87.9% | 704.694 | 0.00e+00 | 99.2% |
430 | MT264221 | Promachocrinus kerguelensis voucher SIO:BIC:E4886 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 597 | 87.9% | 704.694 | 0.00e+00 | 99.2% |
431 | MT264280 | Promachocrinus kerguelensis voucher SIO:BIC:E4922 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 597 | 87.9% | 704.694 | 0.00e+00 | 99.2% |
432 | MT264269 | Promachocrinus kerguelensis voucher SIO:BIC:E4927 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 597 | 87.9% | 704.694 | 0.00e+00 | 99.2% |
433 | MT264229 | Promachocrinus kerguelensis voucher SIO:BIC:E11382 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 597 | 87.9% | 704.694 | 0.00e+00 | 99.2% |
434 | MT264274 | Promachocrinus kerguelensis voucher SIO:BIC:E4916 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 597 | 87.9% | 704.694 | 0.00e+00 | 99.2% |
435 | MT264219 | Promachocrinus kerguelensis voucher SIO:BIC:E4885 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 597 | 87.9% | 704.694 | 0.00e+00 | 99.2% |
436 | OP897956 | Annametra occidentalis voucher AB42609747 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 596 | 87.9% | 702.847 | 0.00e+00 | 99.0% |
437 | OP897958 | Annametra occidentalis voucher AB49103183 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 596 | 87.9% | 702.847 | 0.00e+00 | 99.0% |
438 | KR010350 | Comatula solaris voucher DNA spm C324 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 87.9% | 702.847 | 0.00e+00 | 99.0% |
439 | OP897959 | Annametra occidentalis voucher AB49103180 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 596 | 87.9% | 702.847 | 0.00e+00 | 99.0% |
440 | OP897957 | Annametra occidentalis voucher AB49142168 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 596 | 87.9% | 702.847 | 0.00e+00 | 99.0% |
441 | OP897955 | Annametra occidentalis voucher AB49142200 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 596 | 87.9% | 702.847 | 0.00e+00 | 99.0% |
442 | KR010351 | Comatula solaris voucher DNA spm C319 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 596 | 87.9% | 702.847 | 0.00e+00 | 99.0% |
443 | MT264241 | Promachocrinus kerguelensis voucher SIO:BIC:E11376 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 597 | 87.8% | 699.154 | 0.00e+00 | 99.2% |
444 | GU327847 | Vityazicrinus sp. GWR-2010 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 87.7% | 702.847 | 0.00e+00 | 100.0% |
445 | MT264185 | Promachocrinus kerguelensis voucher SIO:BIC:E4977 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.7% | 702.847 | 0.00e+00 | 100.0% |
446 | MT264348 | Promachocrinus kerguelensis voucher WAM:Z44919 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.7% | 702.847 | 0.00e+00 | 100.0% |
447 | MT264555 | Promachocrinus sp. f ELM-2023 voucher AAD-149 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.7% | 702.847 | 0.00e+00 | 100.0% |
448 | MT264556 | Promachocrinus sp. f ELM-2023 voucher AAD-151 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.7% | 702.847 | 0.00e+00 | 100.0% |
449 | MT264597 | Promachocrinus sp. us ELM-2023 voucher SIO:BIC:E11309 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.7% | 701.001 | 0.00e+00 | 99.8% |
450 | MW385399 | Oxymetra finschii voucher Oxymetra_finschii-SIO-E5854 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.7% | 701.001 | 0.00e+00 | 99.8% |
451 | MT264528 | Promachocrinus sp. us ELM-2023 voucher SIO:BIC:E4503 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.7% | 701.001 | 0.00e+00 | 99.8% |
452 | MT264708 | Promachocrinus sp. us ELM-2023 voucher SIO:BIC:E5000 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.7% | 701.001 | 0.00e+00 | 99.8% |
453 | MT264561 | Promachocrinus sp. us ELM-2023 voucher SIO:BIC:E4834 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.7% | 701.001 | 0.00e+00 | 99.8% |
454 | MT264624 | Promachocrinus sp. us ELM-2023 voucher SIO:BIC:E11364 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.7% | 701.001 | 0.00e+00 | 99.8% |
455 | MT264613 | Promachocrinus sp. us ELM-2023 voucher SIO:BIC:E11327 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.7% | 701.001 | 0.00e+00 | 99.8% |
456 | MT264635 | Promachocrinus sp. us ELM-2023 voucher SIO:BIC:E11224 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.7% | 701.001 | 0.00e+00 | 99.8% |
457 | MW367661 | Himerometra robustipinna voucher H_robustipinna-SIO-E5849 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.7% | 701.001 | 0.00e+00 | 99.8% |
458 | MT264701 | Promachocrinus sp. us ELM-2023 voucher SIO:BIC:E11313 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.7% | 701.001 | 0.00e+00 | 99.8% |
459 | MT264564 | Promachocrinus sp. us ELM-2023 voucher SIO:BIC:E5003 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.7% | 701.001 | 0.00e+00 | 99.8% |
460 | MT264696 | Promachocrinus sp. w ELM-2023 voucher WAM:Z44909 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.7% | 701.001 | 0.00e+00 | 99.8% |
461 | MT264601 | Promachocrinus sp. us ELM-2023 voucher SIO:BIC:E11314 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.7% | 701.001 | 0.00e+00 | 99.8% |
462 | KM491776 | Stephanometra indica voucher MNHN:IE-2013-8125 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 87.7% | 701.001 | 0.00e+00 | 99.8% |
463 | MT264163 | Promachocrinus kerguelensis voucher SIO:BIC:E11357 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
464 | MT264207 | Promachocrinus kerguelensis voucher SIO:BIC:E4979 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
465 | MT264398 | Promachocrinus sp. f ELM-2023 voucher WAM:Z44776 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
466 | MT264258 | Promachocrinus kerguelensis voucher SIO:BIC:E4905 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
467 | MT264172 | Promachocrinus kerguelensis voucher SIO:BIC:E4857 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
468 | KM491768 | Promachocrinus kerguelensis voucher SIO:BIC:E4909 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
469 | MT264209 | Promachocrinus kerguelensis voucher SIO:BIC:E4962 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
470 | MT264388 | Promachocrinus kerguelensis voucher SIO:BIC:E5165E cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
471 | MT264365 | Promachocrinus kerguelensis voucher WAM:Z44753 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
472 | MT264247 | Promachocrinus kerguelensis voucher SIO:BIC:E11378 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
473 | MT264211 | Promachocrinus kerguelensis voucher SIO:BIC:E4844 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
474 | MT264175 | Promachocrinus kerguelensis voucher SIO:BIC:E11351 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
475 | MT264275 | Promachocrinus kerguelensis voucher SIO:BIC:E4912 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
476 | MT264178 | Promachocrinus kerguelensis voucher SIO:BIC:E4972 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
477 | MT264331 | Promachocrinus kerguelensis voucher WAM:Z44896 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
478 | MT264155 | Promachocrinus kerguelensis voucher SIO:BIC:E5005 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
479 | MT264109 | Promachocrinus kerguelensis voucher SIO:BIC:E11227 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
480 | MT264151 | Promachocrinus kerguelensis voucher SIO:BIC:E11272 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
481 | MT264328 | Promachocrinus kerguelensis voucher WAM:Z44149 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
482 | MT264217 | Promachocrinus kerguelensis voucher SIO:BIC:E4900 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
483 | MT264226 | Promachocrinus kerguelensis voucher SIO:BIC:E4879 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
484 | MT264114 | Promachocrinus kerguelensis voucher SIO:BIC:E11234 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
485 | MT264256 | Promachocrinus kerguelensis voucher SIO:BIC:E4897 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
486 | MT264392 | Promachocrinus kerguelensis voucher SIO:BIC:E5165J cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
487 | MT264389 | Promachocrinus kerguelensis voucher SIO:BIC:E5165F cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
488 | MT264097 | Promachocrinus kerguelensis voucher SIO:BIC:E11279 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
489 | MT264637 | Promachocrinus joubini voucher WAM:Z44794 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
490 | MT264176 | Promachocrinus kerguelensis voucher SIO:BIC:E11352 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
491 | MT264146 | Promachocrinus kerguelensis voucher SIO:BIC:E11265 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
492 | MT264713 | Promachocrinus kerguelensis voucher SIO:BIC:E11302 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
493 | MT264104 | Promachocrinus kerguelensis voucher SIO:BIC:E11296 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
494 | MT264318 | Promachocrinus kerguelensis voucher WAM:Z44816 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
495 | MT264142 | Promachocrinus kerguelensis voucher SIO:BIC:E11260 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
496 | MT264386 | Promachocrinus kerguelensis voucher SIO:BIC:E5165B cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 602 | 87.5% | 697.307 | 0.00e+00 | 100.0% |
497 | KM014348 | Colobometridae sp. MMS-2014 voucher MNHN:IE-2013-8040 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 87.5% | 695.461 | 0.00e+00 | 99.8% |
498 | MT264636 | Promachocrinus sp. us ELM-2023 voucher WAM:Z44774 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.5% | 695.461 | 0.00e+00 | 99.8% |
499 | GQ913326 | Himerometra magnipinna cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 601 | 87.5% | 695.461 | 0.00e+00 | 99.8% |
500 | MW367652 | Himerometra robustipinna voucher H_robustipinna-SAM-K1950 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 601 | 87.5% | 695.461 | 0.00e+00 | 99.8% |
Selected alignment ⓘ
Selected taxonomy ⓘ
Domain | |
---|---|
Kingdom | |
Phylum | |
Class | |
Order | |
Family | |
Genus | |
Species |
Click + drag
to pan
Scroll
to zoom in/out
Click
a label to view NCBI record
This phylogenetic tree shows the genetic relationship between the query sequence
(labelled QUERY
)
and matching reference sequences (labelled species/accession).
The tree was computed with
FastME
using the Neighbor-Joining method. Multiple-sequence alignment of the candidate reference sequences was performed using
MAFFT.
The visualization is rendered with
Phylocanvas.GL
.
Leaf nodes are colour-coded to indicate species. The query sequence is selected by default (green circle) and is indicated with a red star.
This sections shows the taxa of interest (TOI) specified by the sample submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity | Database coverage | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Asteridae | Did not match any candidate |
Database coverage of Taxon of Interest AsteridaeThis Taxon of Interest has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Reference database:
Errors encountered:
No database coverage information is available for this taxon. This is likely because the data are insufficient or inappropriate for this analysis, or because an error was encountered during the analysis. |
||||||||||
Acanthaster planci | Did not match any candidate |
Database coverage of Taxon of Interest Acanthaster planciThis Taxon of Interest has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Reference database:
Database coverage of Acanthaster planci
Flag 5.1A:
The reference data supports this taxon well
524 records
There are 524 sequence records in the reference database for Acanthaster planci that have been annotated with the given locus COI. It is possible that more records exist for this taxon which were not correctly annotated with this locus.
Global occurrence records for Acanthaster planci.
Database coverage of species in genus Acanthaster
Flag 5.2B:
The reference data offers some support for species in this genus
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COI Database coverage of species in genus Acanthaster that occur in country of origin Japan
Flag 5.3A:
The reference data supports species in this genus well, when we evaluate only species that occur in the sample's country of origin
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COI |
The following resources can be used to ensure that the given taxonomy is legitimate and current.
Taxa | Database |
---|---|
General | GBIF |
General | ITIS |
Mealybugs & scale | ScaleNet database |
Thrips | Thripswiki |
Spider Mites | Spider Mites Database |
Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
Orthoptera | Orthoptera Species File Online |
Drosophilidae | TaxoDros |
Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
Aphids | Aphid Species File |
Ants |
AntWeb
AntCat |
Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
Tortricidae (tortrix moths) | Tortricidae Resources on the Net |
The following table lists all flags that were raised during the analysis. The Flag column indicates the flag number and value, while the Outcome column describes the outcome of the analysis for that flag. The Level column indicates the severity of the flag, with levels >1 indicating increasing level of concern.
Flag | Analysis | Explanation | Outcome | Level |
---|---|---|---|---|
1A | Candidate selection | 1 candidate species matched with high stringency (identity ≥ 98.5%) | Positive species identification | 1 |
1B | Candidate selection | 2-3 candidate species matched with high stringency (identity ≥ 98.5%) | The analyst should attempt subjective species identification at the genus level | 2 |
1C | Candidate selection | >3 candidate species matched with high stringency (identity ≥ 98.5%) | The analyst should attempt subjective species identification at the genus level | 3 |
1D | Candidate selection | At least one candidate species matched with moderate stringency (identity ≥93.5% and <98.5%) | The analyst should attempt subjective species identification at the genus level | 2 |
1E | Candidate selection | No candidate species matched | Identification not possible (potential unknown species) | 3 |
2A | Taxa of interest analysis | Taxon of interest detected in candidate species | At least one of the taxa of interest matched the candidates species | 1 |
2B | Taxa of interest analysis | Taxon of interest NOT detected in candidate species | None of the taxa of interest matched the candidates species | 3 |
2NA | Taxa of interest analysis | No Taxa of Interest were provided | Could not be assessed | 0 |
4A | Supporting publications | Matching sequence records for this species are from >5 independent sources | Reference sequences are from diverse sources and therefore likely to be reliable | 1 |
4B | Supporting publications | Matching sequence records for this species have only 1-5 independent sources | Reference sequence sources lack diversity and may therefore be unreliable | 2 |
5NA | Database coverage | Criteria to perform this analysis were not met | Database coverage could not be assessed for this taxon. | 0 |
5B | Database coverage | Locus was not provided for this sample | Database coverage could not be fully assessed for this taxon. | 2 |
5.1A | Database representation for target taxon | The given locus for this taxon is well represented in reference database (>5 entries) | The reference data supports this taxon well | 1 |
5.1B | Database representation for target taxon | The given locus for this taxon has limited representation in reference database (≤5 entries) | The reference data has some support for this taxon | 2 |
5.1C | Database representation for target taxon | The given locus for this taxon is not present in reference database (0 entries) | The reference data are likely to be unreliable for this species | 3 |
5.1NA | Database representation for target taxon | Assessment of related species is only possible for taxa at rank genus/species | This taxon could not be fully assessed | 0 |
5.1ERR | Database representation for target taxon | Please see error messages displayed in the Database Coverage report | The analysis could not be completed because an error occurred | 0 |
5.2A | Database representation for related species | >90% of related taxa have reference sequence(s) at the given locus | The reference data supports species in this genus well | 1 |
5.2B | Database representation for related species | 10-90% of related taxa have reference sequence(s) at the given locus | The reference data offers some support for species in this genus | 2 |
5.2C | Database representation for related species | ≤10% of taxon have reference sequence(s) at the given locus | The reference data offers little support for species in this genus | 3 |
5.2NA | Database representation for related species | Assessment of related species is only possible for taxa at rank genus/species | This taxon could not be fully assessed | 0 |
5.2ERR | Database representation for related species | Please see error messages displayed in the Database Coverage report | The analysis could not be completed because an error occurred | 0 |
5.3A | Database representation for related species in country of origin | All species in genus from country of origin have reference sequence(s) for this locus | The reference data supports species in this genus well, when we evaluate only species that occur in the sample's country of origin | 1 |
5.3B | Database representation for related species in country of origin | Not all species in genus from the country of origin have reference sequence(s) for this locus | The reference data offers some support for species in this genus, when we evaluate only species that occur in the sample's country of origin | 2 |
5.3C | Database representation for related species in country of origin | No species in genus have been observed in the country of origin | It's unlikely that the true taxonomic identity is another species in this genus, because no others have been recorded in the sample's country of origin | 0 |
5.3NA | Database representation for related species in country of origin | Assessment of related species is only possible for taxa at rank genus/species | This taxon could not be fully assessed | 0 |
5.3ERR | Database representation for related species in country of origin | Please see error messages displayed in the Database Coverage report | The analysis could not be completed because an error occurred | 0 |
6A | Phylogenetic assessment | Candidate species grouped within single clade | The query sequence is genetically consistent with sequences of the best-matching species | 1 |
6B | Phylogenetic assessment | The query sequence clusters as sister to a species-specific clade or as a single branch in a tree | The sample is genetically distinct from the sequences of the best-matching species, and may lack representation in the reference database. This indicates that the sample organism is either poorly studied or a potential novel species. | 2 |
6C | Phylogenetic assessment | Genotype diversity grouped into multiple diverse groups | The top candidate species cannot be confidently distinguished from other related species | 3 |
7A | Preliminary identification confirmation | Identified species is consistent with preliminary ID | The preliminary identification is supported by the molecular data | 1 |
7B | Preliminary identification confirmation | Identified species is not consistent with preliminary ID | The molecular data contradicts the preliminary identification | 3 |
7NA | Preliminary identification confirmation | Insufficient evidence due to inconclusive taxonomy of the sample | Cannot confirm or reject the preliminary ID | 0 |