Taxonomic identification report
Sample ID: ON075825
Reference database: BLAST
Report generated from the Taxonomic Identification Nextflow workflow
This report describes the results of a taxonomic identification analysis for the sample
ON075825.
The analysis compares the sample's DNA sequence against a reference database of sequences with known taxonomy.
The results include the best matches from the database, which are referred to as "Candidates". To provide rigour, the report also includes an analysis of supporting publications (a measure of the integrity of candidate hit sequences), and database coverage of the different taxa that are of interest to the report.
| Facility | Cairns Airport |
| Analyst | John Doe |
| Analysis start | 2025-05-10 07:00:00 |
| Analysis end | 2025-05-29 14:52:17 |
| Wall time |
463:52:17
hours
|
Result overview
Inconclusive
Reasoning: 2-3 candidate species matched with high stringency (identity ≥ 98.5%).
| Preliminary morphology ID Epinephelus confirmed? | NA |
|
Flag 7NA
ⓘ
Outcome:
Insufficient evidence due to inconclusive taxonomy of the sample.
Reasoning: Cannot confirm or reject the preliminary ID. |
Database coverage of Preliminary Morphology ID Epinephelus
This Preliminary Morphology ID has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error).
For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Reference database:
NCBI Core Nt
| Coverage of Epinephelus | |
| Coverage of species in genus Epinephelus | |
| Coverage of species in genus Epinephelus in country of origin China |
Database coverage of Epinephelus
Flag 5.1A:
The reference data supports this taxon well
Reasoning: The given locus for this taxon is well represented in reference database (>5 entries)
There are 631 sequence records in the reference database for Epinephelus that have been annotated with the given locus COX1. It is possible that more records exist for this taxon which were not correctly annotated with this locus.
Global occurrence records for Epinephelus.
Note that the occurrence data are not exhaustive, since the data fetched are limited to 5000 occurrence records.
It is therefore possible for this species to occur in regions not shown on the map.
Database coverage of species in genus Epinephelus
Flag 5.2B:
The reference data offers some support for species in this genus
Reasoning: 10-90% of related taxa have reference sequence(s) at the given locus
/ (%) of species have sequence records in the reference database for:
- Species in the genus Epinephelus
- At the target locus COX1
Number of GenBank records at locus COX1
Database coverage of species in genus Epinephelus that occur in country of origin China
Flag 5.3A:
The reference data supports species in this genus well, when we evaluate only species that occur in the sample's country of origin
Reasoning: All species in genus from country of origin have reference sequence(s) for this locus
/ (%) of species have sequence records in the reference database for:
- Species in the genus Epinephelus
- At the target locus COX1
- In the sample country of origin China
Number of GenBank records at locus COX1
| Taxa of interest detected? | True |
|
Outcome:
At least one of the taxa of interest matched the candidates species.
Reasoning: Taxon of interest detected in candidate species.
Outcome:
The reference data supports this taxon well.
Reasoning: The given locus for this taxon is well represented in reference database (>5 entries).
Outcome:
The reference data offers some support for species in this genus.
Reasoning: 10-90% of related taxa have reference sequence(s) at the given locus. |
|
Sample metadata ⓘ
| Locus | COX1 |
| Preliminary ID | Epinephelus |
| Taxa of interest |
Epinephelus Epinephelus awoara |
| Country | China |
| Host | fishing net |
| Sample ID | ON075825 |
| Locus provided | True |
| Query DNA sequence |
Input DNA sequence
>ON075825.1 Epinephelus coioides cyclooxygenase 1 (COX1) mRNA, complete cds ATGAAAGCGTTTAGTATCTTCTCCATCTGGGTGCTTATCAACCTGCTGCTTCTGAAGAGC TCATCATGTGCCGCTGACTCAAGTGTTGTGAACCCCTGTTGTTACTACCCTTGCCAGAAC TCAGGAGTGTGTGTCAGATTTGGTGCAGATCGCTACGAATGTGACTGCACTCGCACTGGC TTCTATGGGAAGAACTGCTCTGTTCCGGAGCTCTGGACAAGAGTTCGTCTCATGCTTAAG CCGAGTCCTGCAGTGGTTCACTTCATCCTCACCCACTTCAAGTTGTTCTGGGACCTCGTC AACAGCACCTTCCTGCGAGACACATTCATGAGATTAGTGCTGATAGTCAGGAGTGACCTT ATTCCAAGCCCTCCAACCTACAACACCAAATATGGATACCTTAGCTGGGAGTCCTACTAC AACGCCTCCTACTACACCCGTCTCCTCCCTCCTGTGCCCAAAGACTGCCCTTTGCCGATG GGAACTAAAGGTAAACCAGAGCTTCCTGATCCCAAAGTGTTGGCCGGGAGGTTTTTTAGG AGAAAGACATTCAGGCCGGACCCCCAGGGAACCAATGTGATGTTTGCCTTCATGGCCCAA CACTTCACCCACCAGTTTTTCAAGACAAACCAAAAAGCTCAAGGTGGCTTCACCAAGGCT TTAGGACATGGGGTAGATGCAGGTAATATCTATGGAGACAACCTCATGCGACAGCTTCAA CTCCGGCTTCATGAAGATGGAAAACTTAAATATCAGTTAGTAAATGGTGATGTGTACCCT CCTTCAGTATCTGAAGTCCCTGTGGACATGGTTTATCCTGAGAGTTTCCCTCCAGAGAAG CGTCTGGTCATGGGTCAGGAGCTGTTTGGCCTCCTGCCGGGCCTCACCATGTACGCCACC ATATGGCTGAGAGAGCACAACAGAGTCTGTGACATCCTGAAGGCAGAACATCCCACCTGG GATGATGAGCAGCTCTTCCAGACCGCCAGACTCATCATCATTGGTGAGATCATCAACATC ATAATAGAAGAGTACGTGCAGCACCTGAGTGGTTACTATCTGGACCTGAAGTTCGATCCC ACTCTGCTCTTCAACTCACGTTTCCAGTACAGCAACCGCATCGCTCTGGAGTTCGTCCAC CTCTACCACTGGCACCCACTGATGCCCGACAGCTTCCTCATTGACGGAGAAGAAATCCCA TACTCCCAGTTCATGCACAACACCTCCCTCCTCTTGCACTACGGGGTGGAGAAACTGGTG GATGCCTTCTCTCGACAACCTGCAGGACAGATAGGTGGAGGTCGTAACTCTAATGACATA GTGCTCAGAGTGGCGGAGATGGTCATCAGAGAGTCGCGAGCAACACGTGTGCGGCCCTTC AATGAATACAGGAAGAGGTTCAACCTGAAGCCATACACCTCTTTTTATGAGTTTACTGGT GACATGGAAATAGCCAGAGATTTAGAGGAGCTCTACGGTGACATCGATGCTTTGGAGTTC TACCCCGGTGTCATGCTGGAGAAAACACGTCCCAACAGGCTGTTTGGTGAGAGTATGGTG GAGATGGGTGCTCCCTTCTCCCTGAAAGGCCTGCTGGGAAACCCCATCTGCTCCCCTGAG TACTGGAAGCCCAGCACCTTTGGGGGCGAGACCGGCTTCAACATCGTCAAAACTTCCACT TTGAAGAAACTGGTGTGCCTCAACACCAAGTGGTGTCCATACGTGGACTTCCATGTTCCA CGAAATGAGGAGGAGGCAAAACCAAGGGAACCATCCACTGAGCTTTAA
Workflow parameters
metadata
|
metadata.csv
|
outdir
|
output_v025
|
publish_dir_mode
|
None
|
email
|
None
|
email_on_fail
|
None
|
plaintext_email
|
False
|
monochrome_logs
|
False
|
help
|
False
|
help_full
|
False
|
show_hidden
|
False
|
version
|
False
|
pipelines_testdata_base_path
|
https://raw.githubusercontent.com/nf-core/test-datasets/
|
trace_report_suffix
|
2025-05-21_07-46-56
|
config_profile_name
|
None
|
config_profile_description
|
None
|
custom_config_version
|
master
|
sequences
|
query.fasta
|
blastdb
|
/home/ubuntu/blastdbs/20250329/core_nt
|
taxdb
|
/home/ubuntu/.taxonkit/
|
ncbi_api_key
|
d2c2e49b459493d627948bc7d5a07fca5c08
|
user_email
|
magdalena.antczak@qcif.edu.au
|
analyst_name
|
Magdalena Antczak
|
facility_name
|
QCIF
|
custom_config_base
|
https://raw.githubusercontent.com/nf-core/configs/master
|
config_profile_contact
|
None
|
config_profile_url
|
None
|
validate_params
|
True
|
accessions_filename
|
accessions.txt
|
taxonomy_filename
|
taxonomy.csv
|
query_title_filename
|
query_title.txt
|
hits_json_filename
|
hits.json
|
hits_fasta_filename
|
all_blast_hits.fasta
|
flags_csv_filename
|
flags.json
|
taxonomy_id_filename
|
assigned_taxonomy.txt
|
candidates_fasta_filename
|
candidates.fasta
|
candidates_csv_filename
|
candidates.csv
|
candidates_json_filename
|
candidates.json
|
toi_detected_csv_filename
|
taxa_of_concern_detected.csv
|
min_nt
|
400
|
min_q_coverage
|
0.85
|
min_identity
|
0.935
|
min_identity_strict
|
0.985
|
timestamp_filename
|
timestamp.txt
|
pmi_match_csv_filename
|
pmi_match_results.csv
|
candidates_sources_json_filename
|
candidates_sources.json
|
db_coverage_json_filename
|
db_coverage.json
|
gbif_accepted_status
|
accepted,doubtful
|
gbif_limit_records
|
500
|
tree_nwk_filename
|
candidates.nwk
|
boxplot_img_filename
|
candidates_identity_boxplot.png
|
allowed_loci_file
|
/home/ubuntu/nextflow-pipeline/daff-taxassignwf/assets/loci.json
|
Workflow program versions
blast
|
2.16.0+
|
fastme
|
2.1.6.3
|
mafft
|
7.52
|
daff/taxassignwf
|
v0.2.5
|
Nextflow
|
24.10.6
|
Analyst evaluation
Identification of candidate species
Reasoning: 2-3 candidate species matched with high stringency (identity ≥ 98.5%).
ⓘ BLAST hits must meet ONE of these criteria to be considered for candidate screening:
| Minimum alignment length ⓘ |
300bp
|
| Minimum query coverage ⓘ |
85.0%
|
BLAST hits have been classified as follows:
| Classification | Alignment identity ⓘ | Number of hits ⓘ | Number of species ⓘ |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 3 | 3 |
| MODERATE MATCH | ≥ 93.5% | NA | NA |
| NO MATCH | < 93.5% |
Candidate species
| Species | Hits ⓘ | Identity ⓘ | E-value ⓘ | Database coverage ⓘ | ||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Epinephelus coioides | 1 | 100.0% | 0.0 |
Database coverage of Candidate Epinephelus coioidesThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Reference database:
Database coverage of Epinephelus coioides
Flag 5.1A:
The reference data supports this taxon well
72 records
There are 72 sequence records in the reference database for Epinephelus coioides that have been annotated with the given locus COX1. It is possible that more records exist for this taxon which were not correctly annotated with this locus. 
Global occurrence records for Epinephelus coioides.
Database coverage of species in genus Epinephelus
Flag 5.2B:
The reference data offers some support for species in this genus
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COX1 Database coverage of species in genus Epinephelus that occur in country of origin China
Flag 5.3A:
The reference data supports species in this genus well, when we evaluate only species that occur in the sample's country of origin
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COX1 |
||||||
| Epinephelus lanceolatus | 1 | 100.0% | 0.0 |
Database coverage of Candidate Epinephelus lanceolatusThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Reference database:
Database coverage of Epinephelus lanceolatus
Flag 5.1B:
The reference data has some support for this taxon
5 records
There are 5 sequence records in the reference database for Epinephelus lanceolatus that have been annotated with the given locus COX1. It is possible that more records exist for this taxon which were not correctly annotated with this locus. 
Global occurrence records for Epinephelus lanceolatus.
Database coverage of species in genus Epinephelus
Flag 5.2B:
The reference data offers some support for species in this genus
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COX1 Database coverage of species in genus Epinephelus that occur in country of origin China
Flag 5.3A:
The reference data supports species in this genus well, when we evaluate only species that occur in the sample's country of origin
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COX1 |
||||||
| Epinephelus moara | 1 | 98.7% | 0.0 |
Database coverage of Candidate Epinephelus moaraThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Reference database:
Database coverage of Epinephelus moara
Flag 5.1C:
The reference data are likely to be unreliable for this species
0 records
There are 0 sequence records in the reference database for Epinephelus moara that have been annotated with the given locus COX1. It is possible that more records exist for this taxon which were not correctly annotated with this locus. 
No map could be generated for this taxon, most likely due to an error in the GBIF Occurrence API. Please check for errors above. Database coverage of species in genus Epinephelus
Flag 5.2B:
The reference data offers some support for species in this genus
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COX1 Database coverage of species in genus Epinephelus that occur in country of origin China
Flag 5.3A:
The reference data supports species in this genus well, when we evaluate only species that occur in the sample's country of origin
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COX1 |
BLAST search results
This table shows all results that were returned by the BLAST search.
Each row represents a reference sequence that matched the query
sequence.
Use CTRL+F to search the table, and click table headers
to sort by column. Click on a row to show the corresponding BLAST
alignment and taxonomy information in the bottom panes.
| Rank ⓘ | Accession ⓘ | Hit subject ⓘ | Align length ⓘ | Query coverage ⓘ | Bitscore ⓘ | E-value ⓘ | Identity ⓘ |
|---|---|---|---|---|---|---|---|
| 1 | ON075825 | Epinephelus coioides cyclooxygenase 1 (COX1) mRNA, complete cds | 1788 | 100.0% | 3302.93 | 0.00e+00 | 100.0% |
| 2 | XM_033618714 | PREDICTED: Epinephelus lanceolatus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1788 | 100.0% | 3302.93 | 0.00e+00 | 100.0% |
| 3 | XM_032980577 | PREDICTED: Petromyzon marinus uncharacterized LOC116958091 (LOC116958091), mRNA | 28 | 1.6% | 52.8265 | 1.70e-01 | 100.0% |
| 4 | XM_050051969 | PREDICTED: Epinephelus moara prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1788 | 100.0% | 3175.51 | 0.00e+00 | 98.7% |
| 5 | XM_049579369 | PREDICTED: Epinephelus fuscoguttatus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1788 | 100.0% | 3125.65 | 0.00e+00 | 98.2% |
| 6 | XM_042488709 | PREDICTED: Plectropomus leopardus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1287 | 72.0% | 1746.2 | 0.00e+00 | 91.1% |
| 7 | XM_044197069 | PREDICTED: Siniperca chuatsi prostaglandin G/H synthase 1-like (LOC122876567), transcript variant X3, mRNA | 1701 | 95.1% | 2250.34 | 0.00e+00 | 90.5% |
| 8 | XM_044197070 | PREDICTED: Siniperca chuatsi prostaglandin G/H synthase 1-like (LOC122876567), transcript variant X4, mRNA | 1701 | 95.1% | 2250.34 | 0.00e+00 | 90.5% |
| 9 | XM_037776566 | PREDICTED: Sebastes umbrosus prostaglandin G/H synthase 1-like (LOC119492250), mRNA | 1788 | 100.0% | 2340.83 | 0.00e+00 | 90.3% |
| 10 | XM_044197067 | PREDICTED: Siniperca chuatsi prostaglandin G/H synthase 1-like (LOC122876567), transcript variant X1, mRNA | 1788 | 100.0% | 2338.98 | 0.00e+00 | 90.3% |
| 11 | XR_006378093 | PREDICTED: Siniperca chuatsi prostaglandin G/H synthase 1-like (LOC122876567), transcript variant X2, misc_RNA | 1788 | 100.0% | 2338.98 | 0.00e+00 | 90.3% |
| 12 | XM_066677716 | PREDICTED: Hoplias malabaricus prostaglandin-endoperoxide synthase 2a (ptgs2a), mRNA | 103 | 5.8% | 135.926 | 1.64e-26 | 90.3% |
| 13 | XM_031305840 | PREDICTED: Sander lucioperca prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X4, mRNA | 1701 | 95.1% | 2222.64 | 0.00e+00 | 90.2% |
| 14 | XM_031305839 | PREDICTED: Sander lucioperca prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X3, mRNA | 1700 | 95.1% | 2220.79 | 0.00e+00 | 90.2% |
| 15 | XM_026043739 | PREDICTED: Nothoprocta perdicaria prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 92 | 5.1% | 121.153 | 4.60e-22 | 90.2% |
| 16 | XM_031305836 | PREDICTED: Sander lucioperca prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1788 | 100.0% | 2318.67 | 0.00e+00 | 90.1% |
| 17 | XM_039804595 | PREDICTED: Perca fluviatilis prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1700 | 95.1% | 2193.09 | 0.00e+00 | 89.9% |
| 18 | XM_039804596 | PREDICTED: Perca fluviatilis prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X3, mRNA | 1700 | 95.1% | 2193.09 | 0.00e+00 | 89.9% |
| 19 | XM_028577704 | PREDICTED: Perca flavescens prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X6, mRNA | 1701 | 95.1% | 2189.4 | 0.00e+00 | 89.9% |
| 20 | XM_028577703 | PREDICTED: Perca flavescens prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X5, mRNA | 1701 | 95.1% | 2189.4 | 0.00e+00 | 89.9% |
| 21 | XM_028577701 | PREDICTED: Perca flavescens prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X3, mRNA | 1700 | 95.1% | 2187.55 | 0.00e+00 | 89.9% |
| 22 | XM_028577702 | PREDICTED: Perca flavescens prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X4, mRNA | 1700 | 95.1% | 2187.55 | 0.00e+00 | 89.9% |
| 23 | XM_039804594 | PREDICTED: Perca fluviatilis prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1788 | 100.0% | 2290.97 | 0.00e+00 | 89.8% |
| 24 | XR_010166989 | PREDICTED: Eleginops maclovinus uncharacterized LOC134873841 (LOC134873841), ncRNA | 334 | 18.7% | 441.743 | 1.43e-118 | 89.8% |
| 25 | XM_028577700 | PREDICTED: Perca flavescens prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1788 | 100.0% | 2274.35 | 0.00e+00 | 89.7% |
| 26 | XR_003692557 | PREDICTED: Perca flavescens prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, misc_RNA | 1788 | 100.0% | 2274.35 | 0.00e+00 | 89.7% |
| 27 | XM_031849616 | PREDICTED: Anarrhichthys ocellatus prostaglandin G/H synthase 1-like (LOC116384705), mRNA | 1788 | 100.0% | 2389.962 | 0.00e+00 | 89.5% |
| 28 | XM_031305838 | PREDICTED: Sander lucioperca prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1788 | 100.0% | 2233.72 | 0.00e+00 | 89.4% |
| 29 | XM_054610851 | PREDICTED: Anoplopoma fimbria prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1788 | 100.0% | 2235.57 | 0.00e+00 | 89.3% |
| 30 | XM_046036006 | PREDICTED: Micropterus dolomieu prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1764 | 98.7% | 2206.02 | 0.00e+00 | 89.2% |
| 31 | XM_038704082 | Micropterus salmoides prostaglandin G/H synthase 1 (ptgs1), mRNA | 1764 | 98.7% | 2206.02 | 0.00e+00 | 89.2% |
| 32 | XM_009822287 | PREDICTED: Gavia stellata prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 101 | 5.6% | 126.692 | 9.89e-24 | 89.1% |
| 33 | XM_034872661 | PREDICTED: Etheostoma cragini prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1710 | 95.6% | 2108.15 | 0.00e+00 | 89.0% |
| 34 | XM_010736825 | PREDICTED: Larimichthys crocea prostaglandin G/H synthase 1 (LOC104923661), mRNA | 1787 | 99.9% | 2204.17 | 0.00e+00 | 88.9% |
| 35 | XM_068721069 | PREDICTED: Cebidichthys violaceus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1788 | 100.0% | 2202.33 | 0.00e+00 | 88.9% |
| 36 | XM_029439085 | PREDICTED: Cottoperca gobio prostaglandin G/H synthase 1-like (LOC115013092), mRNA | 1788 | 100.0% | 2185.71 | 0.00e+00 | 88.8% |
| 37 | XM_034872660 | PREDICTED: Etheostoma cragini prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1788 | 100.0% | 2183.86 | 0.00e+00 | 88.8% |
| 38 | XM_010778638 | PREDICTED: Notothenia coriiceps prostaglandin G/H synthase 1-like (LOC104951901), mRNA | 734 | 41.1% | 896.745 | 0.00e+00 | 88.7% |
| 39 | XM_037099447 | PREDICTED: Acanthopagrus latus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X3, mRNA | 1670 | 93.4% | 2028.016 | 0.00e+00 | 88.6% |
| 40 | XM_032515515 | PREDICTED: Etheostoma spectabile prostaglandin G/H synthase 1-like (LOC116689125), transcript variant X1, mRNA | 1788 | 100.0% | 2150.62 | 0.00e+00 | 88.5% |
| 41 | XM_032515516 | PREDICTED: Etheostoma spectabile prostaglandin G/H synthase 1-like (LOC116689125), transcript variant X2, mRNA | 1788 | 100.0% | 2150.62 | 0.00e+00 | 88.5% |
| 42 | XM_010778639 | PREDICTED: Notothenia coriiceps prostaglandin G/H synthase 1-like (LOC104951902), mRNA | 999 | 55.9% | 1208.83 | 0.00e+00 | 88.5% |
| 43 | XM_041936725 | PREDICTED: Chelmon rostratus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1788 | 100.0% | 2156.16 | 0.00e+00 | 88.4% |
| 44 | XM_034118616 | PREDICTED: Trematomus bernacchii prostaglandin G/H synthase 1-like (LOC117473125), mRNA | 1767 | 98.8% | 2119.23 | 0.00e+00 | 88.4% |
| 45 | XM_034091701 | PREDICTED: Pseudochaenichthys georgianus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1755 | 98.2% | 2108.15 | 0.00e+00 | 88.4% |
| 46 | XM_035657964 | PREDICTED: Morone saxatilis prostaglandin G/H synthase 1-like (LOC118325335), mRNA | 502 | 28.1% | 606.821 | 2.90e-168 | 88.4% |
| 47 | XM_041936726 | PREDICTED: Chelmon rostratus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1788 | 100.0% | 2141.39 | 0.00e+00 | 88.3% |
| 48 | AP029628 | Trachurus japonicus A0001 DNA, chromosome 9, sequence | 118 | 6.6% | 141.466 | 3.53e-28 | 88.3% |
| 49 | XM_051423209 | PREDICTED: Dicentrarchus labrax prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1788 | 100.0% | 2134.0 | 0.00e+00 | 88.2% |
| 50 | XM_037099445 | PREDICTED: Acanthopagrus latus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1765 | 98.7% | 2102.61 | 0.00e+00 | 88.2% |
| 51 | XM_037099446 | PREDICTED: Acanthopagrus latus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1765 | 98.7% | 2102.61 | 0.00e+00 | 88.2% |
| 52 | XM_034225346 | PREDICTED: Gymnodraco acuticeps prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1755 | 98.2% | 2085.99 | 0.00e+00 | 88.2% |
| 53 | XM_030415994 | PREDICTED: Sparus aurata prostaglandin G/H synthase 1-like (LOC115581124), mRNA | 1772 | 99.1% | 2104.45 | 0.00e+00 | 88.1% |
| 54 | XM_037099448 | PREDICTED: Acanthopagrus latus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X4, mRNA | 1765 | 98.7% | 2082.29 | 0.00e+00 | 88.0% |
| 55 | XM_023417095 | PREDICTED: Seriola lalandi dorsalis prostaglandin G/H synthase 1-like (LOC111663044), mRNA | 1788 | 100.0% | 2100.76 | 0.00e+00 | 87.9% |
| 56 | XM_022765172 | PREDICTED: Seriola dumerili prostaglandin G/H synthase 1-like (LOC111236442), transcript variant X2, mRNA | 1700 | 95.1% | 1999.2 | 0.00e+00 | 87.9% |
| 57 | XM_056377099 | PREDICTED: Seriola aureovittata prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1788 | 100.0% | 2095.22 | 0.00e+00 | 87.8% |
| 58 | XM_022765171 | PREDICTED: Seriola dumerili prostaglandin G/H synthase 1-like (LOC111236442), transcript variant X1, mRNA | 1788 | 100.0% | 2095.22 | 0.00e+00 | 87.8% |
| 59 | XM_063897721 | PREDICTED: Eleginops maclovinus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1752 | 98.0% | 2056.44 | 0.00e+00 | 87.8% |
| 60 | XM_051075232 | PREDICTED: Lates calcarifer prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1702 | 95.2% | 1964.11 | 0.00e+00 | 87.5% |
| 61 | XM_035657965 | PREDICTED: Morone saxatilis prostaglandin G/H synthase 1-like (LOC118325336), mRNA | 1788 | 100.0% | 2050.9 | 0.00e+00 | 87.4% |
| 62 | EU703784 | Myoxocephalus octodecemspinosus cyclooxygenase-1a mRNA, complete cds | 1788 | 100.0% | 2050.9 | 0.00e+00 | 87.4% |
| 63 | XM_018664763 | PREDICTED: Lates calcarifer prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1788 | 100.0% | 2050.9 | 0.00e+00 | 87.4% |
| 64 | XM_041042972 | PREDICTED: Toxotes jaculatrix prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X3, mRNA | 1673 | 93.6% | 1916.1 | 0.00e+00 | 87.4% |
| 65 | XM_041042971 | PREDICTED: Toxotes jaculatrix prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1672 | 93.5% | 1914.25 | 0.00e+00 | 87.4% |
| 66 | XM_068604972 | PREDICTED: Clinocottus analis prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1745 | 97.6% | 1988.12 | 0.00e+00 | 87.3% |
| 67 | XM_040155965 | PREDICTED: Xiphias gladius prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1670 | 93.4% | 1905.02 | 0.00e+00 | 87.3% |
| 68 | KU188277 | Lates calcarifer cyclooxygenase 1b (COX1b) mRNA, partial cds | 999 | 55.9% | 1142.35 | 0.00e+00 | 87.3% |
| 69 | XM_035640886 | PREDICTED: Scophthalmus maximus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1643 | 91.9% | 1878.433 | 0.00e+00 | 87.3% |
| 70 | XM_034542161 | PREDICTED: Cyclopterus lumpus prostaglandin G/H synthase 1-like (LOC117736668), mRNA | 1788 | 100.0% | 2012.12 | 0.00e+00 | 87.1% |
| 71 | XM_009988111 | PREDICTED: Tauraco erythrolophus prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) (PTGS2), transcript variant X2, mRNA | 101 | 5.6% | 115.613 | 2.14e-20 | 87.1% |
| 72 | XM_009988110 | PREDICTED: Tauraco erythrolophus prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) (PTGS2), transcript variant X1, mRNA | 101 | 5.6% | 115.613 | 2.14e-20 | 87.1% |
| 73 | XM_009988112 | PREDICTED: Tauraco erythrolophus prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) (PTGS2), transcript variant X3, mRNA | 101 | 5.6% | 115.613 | 2.14e-20 | 87.1% |
| 74 | XM_040155964 | PREDICTED: Xiphias gladius prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1786 | 99.9% | 2013.97 | 0.00e+00 | 87.0% |
| 75 | XM_059338001 | PREDICTED: Centropristis striata prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1788 | 100.0% | 2012.12 | 0.00e+00 | 87.0% |
| 76 | XM_035640884 | PREDICTED: Scophthalmus maximus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1699 | 95.0% | 1908.71 | 0.00e+00 | 87.0% |
| 77 | XM_041042970 | PREDICTED: Toxotes jaculatrix prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1788 | 100.0% | 1989.96 | 0.00e+00 | 86.9% |
| 78 | XM_056430415 | PREDICTED: Pseudoliparis swirei prostaglandin G/H synthase 1-like (LOC130203947), mRNA | 1444 | 80.8% | 1615.09 | 0.00e+00 | 86.8% |
| 79 | XM_034693087 | PREDICTED: Notolabrus celidotus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1788 | 100.0% | 1973.34 | 0.00e+00 | 86.6% |
| 80 | XM_034693086 | PREDICTED: Notolabrus celidotus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1780 | 99.6% | 1964.11 | 0.00e+00 | 86.6% |
| 81 | XM_040196285 | PREDICTED: Gasterosteus aculeatus aculeatus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1775 | 99.3% | 1945.64 | 0.00e+00 | 86.5% |
| 82 | XM_040196284 | PREDICTED: Gasterosteus aculeatus aculeatus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1770 | 99.0% | 1936.41 | 0.00e+00 | 86.5% |
| 83 | XM_046385467 | PREDICTED: Scatophagus argus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1769 | 98.9% | 1929.02 | 0.00e+00 | 86.4% |
| 84 | XM_044330041 | PREDICTED: Thunnus albacares prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X3, mRNA | 1700 | 95.1% | 1855.16 | 0.00e+00 | 86.4% |
| 85 | XM_023288126 | PREDICTED: Amphiprion ocellaris prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1761 | 98.5% | 1912.4 | 0.00e+00 | 86.3% |
| 86 | XM_042422381 | PREDICTED: Thunnus maccoyii prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X4, mRNA | 1701 | 95.1% | 1845.92 | 0.00e+00 | 86.3% |
| 87 | OZ035024 | Pungitius pungitius genome assembly, chromosome: 13 | 774 | 43.3% | 845.433 | 4.29e-240 | 86.3% |
| 88 | XM_061038439 | PREDICTED: Labrus mixtus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1788 | 100.0% | 1934.56 | 0.00e+00 | 86.2% |
| 89 | XM_026321886 | PREDICTED: Mastacembelus armatus prostaglandin G/H synthase 1-like (LOC113138974), transcript variant X1, mRNA | 1780 | 99.6% | 1921.64 | 0.00e+00 | 86.2% |
| 90 | XM_042422380 | PREDICTED: Thunnus maccoyii prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X3, mRNA | 1700 | 95.1% | 1844.08 | 0.00e+00 | 86.2% |
| 91 | XM_042422379 | PREDICTED: Thunnus maccoyii prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1700 | 95.1% | 1844.08 | 0.00e+00 | 86.2% |
| 92 | XM_026321887 | PREDICTED: Mastacembelus armatus prostaglandin G/H synthase 1-like (LOC113138974), transcript variant X2, mRNA | 1672 | 93.5% | 1805.3 | 0.00e+00 | 86.2% |
| 93 | XM_041936579 | PREDICTED: Chelmon rostratus prostaglandin G/H synthase 1-like (LOC121606335), transcript variant X1, mRNA | 1590 | 88.9% | 1714.085 | 0.00e+00 | 86.2% |
| 94 | XM_037778422 | PREDICTED: Sebastes umbrosus prostaglandin G/H synthase 1-like (LOC119493266), mRNA | 1640 | 91.7% | 1760.98 | 0.00e+00 | 86.1% |
| 95 | XM_051951262 | PREDICTED: Acanthochromis polyacanthus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1786 | 99.9% | 1910.56 | 0.00e+00 | 86.0% |
| 96 | XR_006398302 | PREDICTED: Thunnus albacares prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, misc_RNA | 1788 | 100.0% | 1906.86 | 0.00e+00 | 86.0% |
| 97 | XM_044330030 | PREDICTED: Thunnus albacares prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1788 | 100.0% | 1906.86 | 0.00e+00 | 86.0% |
| 98 | XM_020598198 | PREDICTED: Monopterus albus prostaglandin G/H synthase 1-like (LOC109959089), mRNA | 1788 | 100.0% | 1901.32 | 0.00e+00 | 85.9% |
| 99 | XM_042422378 | PREDICTED: Thunnus maccoyii prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1788 | 100.0% | 1895.78 | 0.00e+00 | 85.9% |
| 100 | XM_041936580 | PREDICTED: Chelmon rostratus prostaglandin G/H synthase 1-like (LOC121606335), transcript variant X2, mRNA | 1572 | 87.9% | 1668.64 | 0.00e+00 | 85.9% |
| 101 | XM_053325279 | PREDICTED: Scomber japonicus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1788 | 100.0% | 1884.7 | 0.00e+00 | 85.8% |
| 102 | XM_044197071 | PREDICTED: Siniperca chuatsi prostaglandin G/H synthase 1-like (LOC122876568), mRNA | 1788 | 100.0% | 1879.16 | 0.00e+00 | 85.7% |
| 103 | XM_067616178 | PREDICTED: Thunnus thynnus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1788 | 100.0% | 1873.62 | 0.00e+00 | 85.7% |
| 104 | XR_010932147 | PREDICTED: Thunnus thynnus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, misc_RNA | 1788 | 100.0% | 1873.62 | 0.00e+00 | 85.7% |
| 105 | XM_010132721 | PREDICTED: Buceros rhinoceros silvestris prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) (PTGS2), mRNA | 98 | 5.5% | 104.533 | 4.63e-17 | 85.7% |
| 106 | XM_062417771 | PREDICTED: Scomber scombrus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1788 | 100.0% | 1868.08 | 0.00e+00 | 85.6% |
| 107 | XR_004632576 | PREDICTED: Notolabrus celidotus uncharacterized LOC117819631 (LOC117819631), ncRNA | 174 | 9.7% | 183.939 | 5.78e-41 | 85.6% |
| 108 | XM_037483688 | PREDICTED: Pungitius pungitius prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1751 | 97.9% | 1821.92 | 0.00e+00 | 85.4% |
| 109 | XM_020643953 | PREDICTED: Labrus bergylta prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1788 | 100.0% | 1845.92 | 0.00e+00 | 85.3% |
| 110 | XM_056420189 | PREDICTED: Pseudoliparis swirei prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1783 | 99.7% | 1831.15 | 0.00e+00 | 85.3% |
| 111 | XM_034596270 | PREDICTED: Hippoglossus hippoglossus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1780 | 99.6% | 1821.92 | 0.00e+00 | 85.2% |
| 112 | XM_067521976 | PREDICTED: Channa argus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1780 | 99.6% | 1821.92 | 0.00e+00 | 85.2% |
| 113 | XM_035164899 | PREDICTED: Hippoglossus stenolepis prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1780 | 99.6% | 1821.92 | 0.00e+00 | 85.2% |
| 114 | XM_020099050 | PREDICTED: Paralichthys olivaceus prostaglandin G/H synthase 1-like (LOC109636984), mRNA | 1780 | 99.6% | 1820.07 | 0.00e+00 | 85.1% |
| 115 | XM_026344208 | PREDICTED: Anabas testudineus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1701 | 95.1% | 1735.12 | 0.00e+00 | 85.1% |
| 116 | XM_061071700 | PREDICTED: Limanda limanda prostaglandin G/H synthase 1-like (LOC133001973), mRNA | 1780 | 99.6% | 1797.91 | 0.00e+00 | 85.0% |
| 117 | XM_041787537 | PREDICTED: Cheilinus undulatus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1734 | 97.0% | 1757.28 | 0.00e+00 | 85.0% |
| 118 | XM_026344209 | PREDICTED: Anabas testudineus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1788 | 100.0% | 1797.91 | 0.00e+00 | 84.9% |
| 119 | XM_044197283 | PREDICTED: Siniperca chuatsi prostaglandin G/H synthase 1-like (LOC122876676), mRNA | 1786 | 99.9% | 1786.83 | 0.00e+00 | 84.8% |
| 120 | XM_046385471 | PREDICTED: Scatophagus argus prostaglandin G/H synthase 1-like (LOC124057349), transcript variant X3, mRNA | 1300 | 72.7% | 1299.31 | 0.00e+00 | 84.8% |
| 121 | XM_041787536 | PREDICTED: Cheilinus undulatus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1788 | 100.0% | 1779.44 | 0.00e+00 | 84.7% |
| 122 | XM_029510140 | PREDICTED: Echeneis naucrates prostaglandin G/H synthase 1-like (LOC115048571), transcript variant X3, mRNA | 1670 | 93.4% | 1663.1 | 0.00e+00 | 84.7% |
| 123 | XM_029510138 | PREDICTED: Echeneis naucrates prostaglandin G/H synthase 1-like (LOC115048571), transcript variant X1, mRNA | 1776 | 99.3% | 1768.36 | 0.00e+00 | 84.6% |
| 124 | XM_030737346 | PREDICTED: Archocentrus centrarchus prostaglandin G/H synthase 1-like (LOC115785598), mRNA | 1739 | 97.3% | 1722.2 | 0.00e+00 | 84.6% |
| 125 | XM_029510139 | PREDICTED: Echeneis naucrates prostaglandin G/H synthase 1-like (LOC115048571), transcript variant X2, mRNA | 1776 | 99.3% | 1757.28 | 0.00e+00 | 84.5% |
| 126 | XM_029510141 | PREDICTED: Echeneis naucrates prostaglandin G/H synthase 1-like (LOC115048571), transcript variant X4, mRNA | 1776 | 99.3% | 1748.05 | 0.00e+00 | 84.5% |
| 127 | XM_008288663 | PREDICTED: Stegastes partitus prostaglandin G/H synthase 1-like (LOC103362336), mRNA | 1784 | 99.8% | 1749.9 | 0.00e+00 | 84.4% |
| 128 | XM_068310389 | PREDICTED: Antennarius striatus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1751 | 97.9% | 1707.42 | 0.00e+00 | 84.3% |
| 129 | XM_068760869 | PREDICTED: Brachionichthys hirsutus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1733 | 96.9% | 1685.26 | 0.00e+00 | 84.3% |
| 130 | XM_053421621 | PREDICTED: Pleuronectes platessa prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1780 | 99.6% | 1714.81 | 0.00e+00 | 84.1% |
| 131 | XM_041936616 | PREDICTED: Chelmon rostratus prostaglandin G/H synthase 1-like (LOC121606358), transcript variant X2, mRNA | 1700 | 95.1% | 1639.1 | 0.00e+00 | 84.1% |
| 132 | XM_046385470 | PREDICTED: Scatophagus argus prostaglandin G/H synthase 1-like (LOC124057349), transcript variant X2, mRNA | 1588 | 88.8% | 1522.029 | 0.00e+00 | 84.1% |
| 133 | XM_058635252 | PREDICTED: Solea solea prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1788 | 100.0% | 1718.5 | 0.00e+00 | 84.0% |
| 134 | XM_058635251 | PREDICTED: Solea solea prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1786 | 99.9% | 1714.81 | 0.00e+00 | 84.0% |
| 135 | XM_046385469 | PREDICTED: Scatophagus argus prostaglandin G/H synthase 1-like (LOC124057349), transcript variant X1, mRNA | 1701 | 95.1% | 1624.33 | 0.00e+00 | 84.0% |
| 136 | XM_041936615 | PREDICTED: Chelmon rostratus prostaglandin G/H synthase 1-like (LOC121606358), transcript variant X1, mRNA | 1745 | 97.6% | 1661.26 | 0.00e+00 | 83.9% |
| 137 | XM_062385048 | PREDICTED: Platichthys flesus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1780 | 99.6% | 1687.11 | 0.00e+00 | 83.8% |
| 138 | XM_005928827 | PREDICTED: Haplochromis burtoni prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1743 | 97.5% | 1652.03 | 0.00e+00 | 83.8% |
| 139 | XR_002274759 | PREDICTED: Monopterus albus uncharacterized LOC109959090 (LOC109959090), ncRNA | 167 | 9.3% | 150.699 | 5.87e-31 | 83.8% |
| 140 | XM_063489406 | PREDICTED: Pelmatolapia mariae prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1743 | 97.5% | 1646.49 | 0.00e+00 | 83.7% |
| 141 | XM_003454164 | PREDICTED: Oreochromis niloticus prostaglandin G/H synthase 1 (LOC100699955), mRNA | 1744 | 97.5% | 1642.79 | 0.00e+00 | 83.7% |
| 142 | XM_044025429 | PREDICTED: Solea senegalensis prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1788 | 100.0% | 1676.03 | 0.00e+00 | 83.6% |
| 143 | XM_004566751 | PREDICTED: Maylandia zebra prostaglandin G/H synthase 1 (LOC101475411), mRNA | 1743 | 97.5% | 1635.41 | 0.00e+00 | 83.6% |
| 144 | XM_026187347 | PREDICTED: Astatotilapia calliptera prostaglandin G/H synthase 1-like (LOC113033501), mRNA | 1743 | 97.5% | 1635.41 | 0.00e+00 | 83.6% |
| 145 | XM_005743108 | PREDICTED: Pundamilia nyererei prostaglandin G/H synthase 1-like (LOC102194354), mRNA | 1743 | 97.5% | 1635.41 | 0.00e+00 | 83.6% |
| 146 | XM_031747303 | PREDICTED: Oreochromis aureus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1743 | 97.5% | 1629.87 | 0.00e+00 | 83.6% |
| 147 | XM_040050990 | PREDICTED: Simochromis diagramma prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1743 | 97.5% | 1629.87 | 0.00e+00 | 83.6% |
| 148 | XM_061730131 | PREDICTED: Cololabis saira prostaglandin G/H synthase 1-like (LOC133451168), mRNA | 1712 | 95.7% | 1600.32 | 0.00e+00 | 83.6% |
| 149 | XM_056418913 | PREDICTED: Pseudoliparis swirei prostaglandin G/H synthase 1-like (LOC130196631), mRNA | 1788 | 100.0% | 1652.03 | 0.00e+00 | 83.5% |
| 150 | XM_006803828 | PREDICTED: Neolamprologus brichardi prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1743 | 97.5% | 1602.17 | 0.00e+00 | 83.3% |
| 151 | XM_007245061 | PREDICTED: Astyanax mexicanus prostaglandin-endoperoxide synthase 2a (ptgs2a), mRNA | 166 | 9.3% | 154.392 | 4.54e-32 | 83.3% |
| 152 | XM_028414870 | PREDICTED: Parambassis ranga prostaglandin G/H synthase 1-like (LOC114441787), transcript variant X1, mRNA | 1698 | 95.0% | 1541.23 | 0.00e+00 | 83.1% |
| 153 | XM_028414871 | PREDICTED: Parambassis ranga prostaglandin G/H synthase 1-like (LOC114441787), transcript variant X2, mRNA | 1664 | 93.1% | 1506.14 | 0.00e+00 | 83.1% |
| 154 | XM_029163670 | PREDICTED: Betta splendens prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1701 | 95.1% | 1535.69 | 0.00e+00 | 83.0% |
| 155 | XM_035123561 | PREDICTED: Zootoca vivipara prostaglandin G/H synthase 2-like (LOC118089145), mRNA | 105 | 5.9% | 95.2994 | 2.79e-14 | 82.9% |
| 156 | XM_042000682 | PREDICTED: Melanotaenia boesemani prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1786 | 99.9% | 1587.39 | 0.00e+00 | 82.8% |
| 157 | XM_036581284 | PREDICTED: Colossoma macropomum prostaglandin-endoperoxide synthase 2b (ptgs2b), mRNA | 156 | 8.7% | 139.619 | 1.27e-27 | 82.8% |
| 158 | EU703782 | Fundulus heteroclitus cyclooxygenase-1a mRNA, partial cds | 1330 | 74.4% | 1171.9 | 0.00e+00 | 82.6% |
| 159 | XM_014024209 | PREDICTED: Austrofundulus limnaeus prostaglandin G/H synthase 1-like (LOC106528924), mRNA | 1708 | 95.5% | 1498.75 | 0.00e+00 | 82.5% |
| 160 | XM_028457141 | PREDICTED: Gouania willdenowi prostaglandin G/H synthase 1-like (LOC114469548), transcript variant X2, mRNA | 1386 | 77.5% | 1203.29 | 0.00e+00 | 82.4% |
| 161 | XM_047590885 | PREDICTED: Mugil cephalus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1771 | 99.0% | 1531.99 | 0.00e+00 | 82.3% |
| 162 | XM_047590884 | PREDICTED: Mugil cephalus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1788 | 100.0% | 1535.69 | 0.00e+00 | 82.2% |
| 163 | XM_028457140 | PREDICTED: Gouania willdenowi prostaglandin G/H synthase 1-like (LOC114469548), transcript variant X1, mRNA | 1682 | 94.1% | 1428.58 | 0.00e+00 | 82.0% |
| 164 | XM_017412275 | PREDICTED: Kryptolebias marmoratus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1703 | 95.2% | 1434.12 | 0.00e+00 | 81.9% |
| 165 | XM_037976358 | PREDICTED: Kryptolebias marmoratus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1703 | 95.2% | 1434.12 | 0.00e+00 | 81.9% |
| 166 | XM_017412276 | PREDICTED: Kryptolebias marmoratus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X3, mRNA | 1703 | 95.2% | 1434.12 | 0.00e+00 | 81.9% |
| 167 | XM_037680887 | PREDICTED: Nematolebias whitei prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1689 | 94.5% | 1408.27 | 0.00e+00 | 81.8% |
| 168 | XM_054731046 | PREDICTED: Nothobranchius furzeri prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1746 | 97.7% | 1441.51 | 0.00e+00 | 81.7% |
| 169 | XM_030144536 | PREDICTED: Sphaeramia orbicularis prostaglandin G/H synthase 1-like (LOC115426414), transcript variant X2, mRNA | 1761 | 98.5% | 1441.51 | 0.00e+00 | 81.5% |
| 170 | XM_030144535 | PREDICTED: Sphaeramia orbicularis prostaglandin G/H synthase 1-like (LOC115426414), transcript variant X1, mRNA | 1761 | 98.5% | 1441.51 | 0.00e+00 | 81.5% |
| 171 | XM_047381823 | PREDICTED: Girardinichthys multiradiatus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1696 | 94.9% | 1376.87 | 0.00e+00 | 81.4% |
| 172 | XM_036144062 | PREDICTED: Fundulus heteroclitus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1695 | 94.8% | 1369.49 | 0.00e+00 | 81.3% |
| 173 | XM_039726361 | PREDICTED: Passer montanus prostaglandin-endoperoxide synthase 2 (PTGS2), transcript variant X2, mRNA | 206 | 11.5% | 165.472 | 2.10e-35 | 81.3% |
| 174 | XM_039726360 | PREDICTED: Passer montanus prostaglandin-endoperoxide synthase 2 (PTGS2), transcript variant X1, mRNA | 206 | 11.5% | 165.472 | 2.10e-35 | 81.3% |
| 175 | XM_030279481 | PREDICTED: Taeniopygia guttata prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 206 | 11.5% | 165.472 | 2.10e-35 | 81.3% |
| 176 | XM_064427762 | PREDICTED: Passer domesticus prostaglandin-endoperoxide synthase 2 (PTGS2), transcript variant X2, mRNA | 206 | 11.5% | 165.472 | 2.10e-35 | 81.3% |
| 177 | XM_064427761 | PREDICTED: Passer domesticus prostaglandin-endoperoxide synthase 2 (PTGS2), transcript variant X1, mRNA | 206 | 11.5% | 165.472 | 2.10e-35 | 81.3% |
| 178 | XM_047381824 | PREDICTED: Girardinichthys multiradiatus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1786 | 99.9% | 1423.04 | 0.00e+00 | 81.2% |
| 179 | XM_030104657 | PREDICTED: Salarias fasciatus prostaglandin G/H synthase 1-like (LOC115398037), mRNA | 1688 | 94.4% | 1339.94 | 0.00e+00 | 81.1% |
| 180 | XM_030105069 | PREDICTED: Salarias fasciatus prostaglandin G/H synthase 1-like (LOC115398352), transcript variant X2, mRNA | 1687 | 94.4% | 1332.55 | 0.00e+00 | 81.0% |
| 181 | XM_030105068 | PREDICTED: Salarias fasciatus prostaglandin G/H synthase 1-like (LOC115398352), transcript variant X1, mRNA | 1687 | 94.4% | 1332.55 | 0.00e+00 | 81.0% |
| 182 | XM_024276021 | PREDICTED: Oryzias melastigma prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1666 | 93.2% | 1304.85 | 0.00e+00 | 81.0% |
| 183 | XM_012878435 | PREDICTED: Fundulus heteroclitus prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1755 | 98.2% | 1371.33 | 0.00e+00 | 80.9% |
| 184 | XM_009088420 | PREDICTED: Serinus canaria prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 206 | 11.5% | 159.932 | 9.75e-34 | 80.9% |
| 185 | XM_036213615 | PREDICTED: Oryzias melastigma prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1666 | 93.2% | 1260.54 | 0.00e+00 | 80.5% |
| 186 | XM_015043689 | PREDICTED: Poecilia latipinna prostaglandin G/H synthase 1-like (LOC106954300), transcript variant X1, mRNA | 1746 | 97.7% | 1319.63 | 0.00e+00 | 80.4% |
| 187 | XM_007557813 | PREDICTED: Poecilia formosa prostaglandin G/H synthase 1-like (LOC103141975), transcript variant X2, mRNA | 1746 | 97.7% | 1319.63 | 0.00e+00 | 80.4% |
| 188 | XM_015043690 | PREDICTED: Poecilia latipinna prostaglandin G/H synthase 1-like (LOC106954300), transcript variant X2, mRNA | 1746 | 97.7% | 1319.63 | 0.00e+00 | 80.4% |
| 189 | XM_016674207 | PREDICTED: Poecilia formosa prostaglandin G/H synthase 1-like (LOC103141975), transcript variant X1, mRNA | 1746 | 97.7% | 1319.63 | 0.00e+00 | 80.4% |
| 190 | XM_021525158 | PREDICTED: Lonchura striata prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 206 | 11.5% | 154.392 | 4.54e-32 | 80.4% |
| 191 | XM_014996967 | PREDICTED: Poecilia mexicana prostaglandin G/H synthase 1-like (LOC106923731), transcript variant X2, mRNA | 1746 | 97.7% | 1308.55 | 0.00e+00 | 80.3% |
| 192 | XM_014996966 | PREDICTED: Poecilia mexicana prostaglandin G/H synthase 1-like (LOC106923731), transcript variant X1, mRNA | 1746 | 97.7% | 1308.55 | 0.00e+00 | 80.3% |
| 193 | XM_032579803 | PREDICTED: Xiphophorus hellerii prostaglandin G/H synthase 1-like (LOC116730499), mRNA | 1746 | 97.7% | 1293.78 | 0.00e+00 | 80.1% |
| 194 | XM_030104667 | PREDICTED: Salarias fasciatus prostaglandin G/H synthase 1-like (LOC115398044), transcript variant X1, mRNA | 1688 | 94.4% | 1247.61 | 0.00e+00 | 80.1% |
| 195 | XM_030104668 | PREDICTED: Salarias fasciatus prostaglandin G/H synthase 1-like (LOC115398044), transcript variant X2, mRNA | 1688 | 94.4% | 1247.61 | 0.00e+00 | 80.1% |
| 196 | XM_006890676 | PREDICTED: Elephantulus edwardii prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) (PTGS1), transcript variant X2, mRNA | 320 | 17.9% | 237.491 | 4.38e-57 | 80.1% |
| 197 | XM_017736490 | PREDICTED: Corvus brachyrhynchos prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 206 | 11.5% | 148.852 | 2.11e-30 | 79.9% |
| 198 | XM_032118374 | PREDICTED: Corvus moneduloides prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 206 | 11.5% | 148.852 | 2.11e-30 | 79.9% |
| 199 | XM_039556443 | PREDICTED: Corvus cornix cornix prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 206 | 11.5% | 148.852 | 2.11e-30 | 79.9% |
| 200 | XM_048313441 | PREDICTED: Corvus hawaiiensis prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 206 | 11.5% | 148.852 | 2.11e-30 | 79.9% |
| 201 | XM_042033920 | PREDICTED: Corvus kubaryi prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 206 | 11.5% | 148.852 | 2.11e-30 | 79.9% |
| 202 | XM_011615980 | PREDICTED: Takifugu rubripes prostaglandin G/H synthase 1-like (LOC101070781), mRNA | 1723 | 96.4% | 1227.3 | 0.00e+00 | 79.6% |
| 203 | XM_023931590 | PREDICTED: Cyanistes caeruleus prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 206 | 11.5% | 143.312 | 9.82e-29 | 79.4% |
| 204 | XM_014884300 | PREDICTED: Sturnus vulgaris prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) (PTGS2), transcript variant X1, mRNA | 206 | 11.5% | 143.312 | 9.82e-29 | 79.4% |
| 205 | XM_014884301 | PREDICTED: Sturnus vulgaris prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) (PTGS2), transcript variant X2, mRNA | 206 | 11.5% | 143.312 | 9.82e-29 | 79.4% |
| 206 | XM_015636330 | PREDICTED: Parus major prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 206 | 11.5% | 143.312 | 9.82e-29 | 79.4% |
| 207 | XM_057033633 | PREDICTED: Takifugu flavidus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1723 | 96.4% | 1199.6 | 0.00e+00 | 79.3% |
| 208 | XM_030059698 | PREDICTED: Myripristis murdjan prostaglandin G/H synthase 1-like (LOC115364988), mRNA | 1745 | 97.6% | 1142.35 | 0.00e+00 | 78.6% |
| 209 | XM_033972632 | PREDICTED: Periophthalmus magnuspinnatus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1700 | 95.1% | 1112.8 | 0.00e+00 | 78.6% |
| 210 | XM_005531316 | PREDICTED: Pseudopodoces humilis prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) (PTGS2), mRNA | 206 | 11.5% | 132.232 | 2.13e-25 | 78.5% |
| 211 | XM_058843298 | PREDICTED: Poecile atricapillus prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 206 | 11.5% | 132.232 | 2.13e-25 | 78.5% |
| 212 | XM_022210509 | PREDICTED: Acanthochromis polyacanthus prostaglandin-endoperoxide synthase 2b (ptgs2b), mRNA | 305 | 17.1% | 187.632 | 4.47e-42 | 78.3% |
| 213 | XM_026793501 | PREDICTED: Zonotrichia albicollis prostaglandin-endoperoxide synthase 2 (PTGS2), transcript variant X2, mRNA | 327 | 18.3% | 206.098 | 1.23e-47 | 78.2% |
| 214 | XM_005487028 | PREDICTED: Zonotrichia albicollis prostaglandin-endoperoxide synthase 2 (PTGS2), transcript variant X1, mRNA | 327 | 18.3% | 206.098 | 1.23e-47 | 78.2% |
| 215 | HF933210 | TPA_asm: Oryzias latipes strain Hd-rR, complete genome assembly, chromosome 4 | 189 | 10.6% | 115.613 | 2.14e-20 | 78.1% |
| 216 | OZ014270 | Equus caballus genome assembly, chromosome: 25 | 164 | 9.2% | 104.533 | 4.63e-17 | 78.0% |
| 217 | XM_061451753 | PREDICTED: Pezoporus flaviventris prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 179 | 10.0% | 104.533 | 4.63e-17 | 77.5% |
| 218 | XM_057402437 | PREDICTED: Pezoporus wallicus prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 179 | 10.0% | 104.533 | 4.63e-17 | 77.5% |
| 219 | XM_068310120 | PREDICTED: Antennarius striatus prostaglandin G/H synthase 1-like (LOC137592169), mRNA | 1766 | 98.8% | 1029.7 | 0.00e+00 | 77.4% |
| 220 | XM_046836685 | PREDICTED: Silurus meridionalis prostaglandin-endoperoxide synthase 2b (ptgs2b), mRNA | 270 | 15.1% | 156.239 | 1.26e-32 | 77.3% |
| 221 | XM_029637471 | PREDICTED: Oncorhynchus nerka prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1705 | 95.4% | 977.998 | 0.00e+00 | 77.2% |
| 222 | XM_014171594 | PREDICTED: Salmo salar prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1648 | 92.2% | 944.758 | 0.00e+00 | 77.2% |
| 223 | XM_049763190 | PREDICTED: Syngnathus scovelli prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1339 | 74.9% | 761.94 | 0.00e+00 | 77.1% |
| 224 | XM_017704117 | PREDICTED: Pygocentrus nattereri prostaglandin-endoperoxide synthase 2a (ptgs2a), mRNA | 564 | 31.5% | 312.478 | 1.17e-79 | 77.1% |
| 225 | XM_036553785 | PREDICTED: Megalops cyprinoides prostaglandin-endoperoxide synthase 2a (ptgs2a), mRNA | 240 | 13.4% | 134.079 | 5.91e-26 | 77.1% |
| 226 | XM_033067810 | PREDICTED: Catharus ustulatus prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 331 | 18.5% | 185.785 | 1.61e-41 | 77.0% |
| 227 | XM_062606273 | PREDICTED: Pezoporus occidentalis prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 179 | 10.0% | 98.9927 | 2.16e-15 | 76.9% |
| 228 | AB039865 | Equus caballus COX-1 mRNA for cyclooxygenase-1, partial cds | 287 | 16.1% | 159.932 | 9.75e-34 | 76.8% |
| 229 | XM_019885530 | PREDICTED: Hippocampus comes prostaglandin G/H synthase 1-like (LOC109525209), mRNA | 1657 | 92.7% | 878.279 | 0.00e+00 | 76.5% |
| 230 | XM_052068859 | PREDICTED: Hippocampus zosterae prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1652 | 92.4% | 863.506 | 0.00e+00 | 76.4% |
| 231 | XM_049763189 | PREDICTED: Syngnathus scovelli prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1673 | 93.6% | 874.586 | 0.00e+00 | 76.3% |
| 232 | XM_052068858 | PREDICTED: Hippocampus zosterae prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1652 | 92.4% | 854.272 | 0.00e+00 | 76.3% |
| 233 | XM_062497510 | PREDICTED: Cinclus cinclus prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 295 | 16.5% | 152.546 | 1.63e-31 | 76.3% |
| 234 | XM_052068860 | PREDICTED: Hippocampus zosterae prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X3, mRNA | 1534 | 85.8% | 785.946 | 0.00e+00 | 76.2% |
| 235 | XM_052068861 | PREDICTED: Hippocampus zosterae prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X4, mRNA | 1534 | 85.8% | 785.946 | 0.00e+00 | 76.2% |
| 236 | XM_033151386 | PREDICTED: Lacerta agilis prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 183 | 10.2% | 95.2994 | 2.79e-14 | 76.2% |
| 237 | XM_051700899 | PREDICTED: Myxocyprinus asiaticus prostaglandin G/H synthase 2-like (LOC127442703), mRNA | 287 | 16.1% | 143.312 | 9.82e-29 | 76.0% |
| 238 | XM_028732513 | PREDICTED: Podarcis muralis prostaglandin G/H synthase 2 (LOC114598628), mRNA | 201 | 11.2% | 100.839 | 5.99e-16 | 76.0% |
| 239 | XM_017834935 | PREDICTED: Lepidothrix coronata prostaglandin-endoperoxide synthase 2 (PTGS2), transcript variant X1, mRNA | 272 | 15.2% | 132.232 | 2.13e-25 | 75.6% |
| 240 | XM_008930938 | PREDICTED: Manacus vitellinus prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 272 | 15.2% | 132.232 | 2.13e-25 | 75.6% |
| 241 | XM_064664036 | PREDICTED: Pseudopipra pipra prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 272 | 15.2% | 132.232 | 2.13e-25 | 75.6% |
| 242 | XM_027749415 | PREDICTED: Pipra filicauda prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 272 | 15.2% | 132.232 | 2.13e-25 | 75.6% |
| 243 | XM_017834936 | PREDICTED: Lepidothrix coronata prostaglandin-endoperoxide synthase 2 (PTGS2), transcript variant X2, mRNA | 272 | 15.2% | 132.232 | 2.13e-25 | 75.6% |
| 244 | XM_028732512 | PREDICTED: Podarcis muralis prostaglandin G/H synthase 2-like (LOC114598627), mRNA | 201 | 11.2% | 89.7595 | 1.30e-12 | 75.4% |
| 245 | XM_027665332 | PREDICTED: Corapipo altera prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 313 | 17.5% | 147.006 | 7.59e-30 | 75.3% |
| 246 | AB292357 | Micropogonias undulatus COX-2 gene for cyclooxygenase-2, complete cds | 284 | 15.9% | 132.232 | 2.13e-25 | 75.3% |
| 247 | XM_007245417 | PREDICTED: Astyanax mexicanus prostaglandin-endoperoxide synthase 2b (ptgs2b), mRNA | 261 | 14.6% | 122.999 | 1.28e-22 | 75.2% |
| 248 | XM_068743655 | PREDICTED: Brachionichthys hirsutus prostaglandin-endoperoxide synthase 2b (ptgs2b), mRNA | 330 | 18.5% | 150.699 | 5.87e-31 | 75.1% |
| 249 | XM_017722442 | PREDICTED: Pygocentrus nattereri prostaglandin-endoperoxide synthase 2b (ptgs2b), mRNA | 312 | 17.4% | 139.619 | 1.27e-27 | 75.1% |
| 250 | XM_027704520 | PREDICTED: Neopelma chrysocephalum prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 313 | 17.5% | 141.466 | 3.53e-28 | 75.0% |
| 251 | XM_014858317 | PREDICTED: Equus asinus prostaglandin-endoperoxide synthase 1 (PTGS1), transcript variant X2, mRNA | 859 | 48.0% | 368.604 | 1.49e-96 | 74.8% |
| 252 | XM_032697067 | PREDICTED: Chiroxiphia lanceolata prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 308 | 17.2% | 132.232 | 2.13e-25 | 74.6% |
| 253 | XM_020621075 | PREDICTED: Monopterus albus prostaglandin G/H synthase 1-like (LOC109972312), mRNA | 1621 | 90.7% | 673.301 | 0.00e+00 | 74.5% |
| 254 | XM_008526882 | PREDICTED: Equus przewalskii prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) (PTGS1), transcript variant X2, mRNA | 865 | 48.4% | 357.524 | 3.22e-93 | 74.5% |
| 255 | XM_068952377 | PREDICTED: Struthio camelus prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 268 | 15.0% | 113.766 | 7.70e-20 | 74.5% |
| 256 | XM_053391431 | PREDICTED: Podarcis raffonei prostaglandin G/H synthase 2-like (LOC128415343), mRNA | 201 | 11.2% | 84.2195 | 6.04e-11 | 74.5% |
| 257 | XM_006890675 | PREDICTED: Elephantulus edwardii prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) (PTGS1), transcript variant X1, mRNA | 859 | 48.0% | 351.984 | 1.50e-91 | 74.4% |
| 258 | XM_006890677 | PREDICTED: Elephantulus edwardii prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) (PTGS1), transcript variant X3, mRNA | 859 | 48.0% | 351.984 | 1.50e-91 | 74.4% |
| 259 | XM_018755178 | PREDICTED: Scleropages formosus prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1648 | 92.2% | 667.761 | 0.00e+00 | 74.3% |
| 260 | XM_028602263 | PREDICTED: Perca flavescens prostaglandin G/H synthase 1-like (LOC114571366), mRNA | 1639 | 91.7% | 662.221 | 0.00e+00 | 74.3% |
| 261 | XM_065673851 | PREDICTED: Lathamus discolor prostaglandin-endoperoxide synthase 2 (PTGS2), transcript variant X1, mRNA | 268 | 15.0% | 108.226 | 3.58e-18 | 74.3% |
| 262 | XM_065673852 | PREDICTED: Lathamus discolor prostaglandin-endoperoxide synthase 2 (PTGS2), transcript variant X2, mRNA | 268 | 15.0% | 108.226 | 3.58e-18 | 74.3% |
| 263 | XM_020082144 | PREDICTED: Paralichthys olivaceus prostaglandin G/H synthase 1-like (LOC109626319), transcript variant X1, mRNA | 1643 | 91.9% | 652.988 | 0.00e+00 | 74.2% |
| 264 | XM_020082147 | PREDICTED: Paralichthys olivaceus prostaglandin G/H synthase 1-like (LOC109626319), transcript variant X4, mRNA | 1643 | 91.9% | 652.988 | 0.00e+00 | 74.2% |
| 265 | XM_024422345 | PREDICTED: Oncorhynchus tshawytscha prostaglandin-endoperoxide synthase 2b (ptgs2b), mRNA | 221 | 12.4% | 93.4528 | 1.00e-13 | 74.2% |
| 266 | XM_039780498 | PREDICTED: Perca fluviatilis phosducin-like (pdcl), mRNA | 1639 | 91.7% | 640.061 | 2.86e-178 | 74.1% |
| 267 | XM_062580971 | PREDICTED: Rhea pennata prostaglandin-endoperoxide synthase 2 (PTGS2), mRNA | 268 | 15.0% | 108.226 | 3.58e-18 | 74.1% |
| 268 | XM_031317873 | PREDICTED: Sander lucioperca phosducin-like (pdcl), mRNA | 1639 | 91.7% | 634.521 | 1.33e-176 | 74.0% |
| 269 | XM_035949029 | PREDICTED: Amphiprion ocellaris phosducin-like (pdcl), mRNA | 1653 | 92.4% | 632.674 | 4.78e-176 | 74.0% |
| 270 | XM_015009016 | PREDICTED: Poecilia mexicana prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) (ptgs1), mRNA | 1587 | 88.8% | 616.055 | 4.81e-171 | 74.0% |
| 271 | XM_007571512 | PREDICTED: Poecilia formosa prostaglandin-endoperoxide synthase 1 (ptgs1), mRNA | 1587 | 88.8% | 616.055 | 4.81e-171 | 74.0% |
| 272 | XM_015058168 | PREDICTED: Poecilia latipinna prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) (ptgs1), mRNA | 1587 | 88.8% | 604.975 | 1.04e-167 | 73.9% |
| 273 | XM_055052693 | PREDICTED: Poeciliopsis prolifica prostaglandin G/H synthase 1-like (LOC129374323), mRNA | 1573 | 88.0% | 601.281 | 1.35e-166 | 73.9% |
| 274 | DQ246452 | Equus caballus prostaglandin-endoperoxide synthase 1 (Ptgs1) mRNA, partial cds | 580 | 32.4% | 219.025 | 1.59e-51 | 73.9% |
| 275 | XM_032570712 | PREDICTED: Xiphophorus hellerii prostaglandin G/H synthase 1-like (LOC116724919), mRNA | 1587 | 88.8% | 599.435 | 4.85e-166 | 73.8% |
| 276 | XM_049001221 | PREDICTED: Brienomyrus brachyistius prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1629 | 91.1% | 599.435 | 4.85e-166 | 73.7% |
| 277 | XM_049001230 | PREDICTED: Brienomyrus brachyistius prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X3, mRNA | 1629 | 91.1% | 599.435 | 4.85e-166 | 73.7% |
| 278 | XM_049001217 | PREDICTED: Brienomyrus brachyistius prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1629 | 91.1% | 599.435 | 4.85e-166 | 73.7% |
| 279 | XM_008423706 | PREDICTED: Poecilia reticulata prostaglandin G/H synthase 1-like (LOC103473446), mRNA | 1587 | 88.8% | 588.355 | 1.05e-162 | 73.7% |
| 280 | XM_028025149 | PREDICTED: Xiphophorus couchianus prostaglandin G/H synthase 1-like (LOC114149351), mRNA | 1587 | 88.8% | 588.355 | 1.05e-162 | 73.7% |
| 281 | XM_023792281 | PREDICTED: Paramormyrops kingsleyae prostaglandin G/H synthase 1-like (LOC111833721), mRNA | 1629 | 91.1% | 593.895 | 2.25e-164 | 73.6% |
| 282 | XM_018759945 | PREDICTED: Scleropages formosus prostaglandin G/H synthase 1-like (LOC108938933), transcript variant X1, mRNA | 1651 | 92.3% | 579.122 | 6.31e-160 | 73.5% |
| 283 | XM_018759946 | PREDICTED: Scleropages formosus prostaglandin G/H synthase 1-like (LOC108938933), transcript variant X2, mRNA | 1651 | 92.3% | 579.122 | 6.31e-160 | 73.5% |
| 284 | XM_044012905 | PREDICTED: Solea senegalensis prostaglandin G/H synthase 1-like (LOC122758638), mRNA | 1564 | 87.5% | 556.962 | 2.96e-153 | 73.5% |
| 285 | XM_062031395 | PREDICTED: Entelurus aequoreus phosducin-like (pdcl), mRNA | 1639 | 91.7% | 579.122 | 6.31e-160 | 73.4% |
| 286 | XM_061876659 | PREDICTED: Nerophis ophidion prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X4, mRNA | 1639 | 91.7% | 568.042 | 1.37e-156 | 73.3% |
| 287 | XM_061876657 | PREDICTED: Nerophis ophidion prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X2, mRNA | 1639 | 91.7% | 568.042 | 1.37e-156 | 73.3% |
| 288 | XM_061876656 | PREDICTED: Nerophis ophidion prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X1, mRNA | 1639 | 91.7% | 568.042 | 1.37e-156 | 73.3% |
| 289 | XM_037265502 | PREDICTED: Syngnathus acus prostaglandin G/H synthase 1-like (LOC119131237), mRNA | 1579 | 88.3% | 545.882 | 6.40e-150 | 73.2% |
| 290 | XM_061876658 | PREDICTED: Nerophis ophidion prostaglandin-endoperoxide synthase 1 (ptgs1), transcript variant X3, mRNA | 1492 | 83.4% | 507.102 | 3.02e-138 | 73.2% |
| 291 | XM_053281643 | PREDICTED: Hemicordylus capensis prostaglandin-endoperoxide synthase 1 (PTGS1), mRNA | 1467 | 82.0% | 505.256 | 1.09e-137 | 73.2% |
| 292 | XM_008526890 | PREDICTED: Equus przewalskii prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) (PTGS1), transcript variant X3, mRNA | 1160 | 64.9% | 375.99 | 8.89e-99 | 72.9% |
| 293 | NM_001163976 | Equus caballus prostaglandin-endoperoxide synthase 1 (PTGS1), mRNA | 1160 | 64.9% | 375.99 | 8.89e-99 | 72.9% |
| 294 | XM_008526872 | PREDICTED: Equus przewalskii prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) (PTGS1), transcript variant X1, mRNA | 1160 | 64.9% | 375.99 | 8.89e-99 | 72.9% |
| 295 | XM_063889925 | PREDICTED: Eleginops maclovinus prostaglandin G/H synthase 1-like (LOC134868647), transcript variant X2, mRNA | 1463 | 81.8% | 470.169 | 3.96e-127 | 72.7% |
| 296 | XM_050126817 | PREDICTED: Alexandromys fortis prostaglandin-endoperoxide synthase 1 (Ptgs1), transcript variant X2, mRNA | 887 | 49.6% | 270.731 | 4.32e-67 | 72.5% |
| 297 | XM_050126816 | PREDICTED: Alexandromys fortis prostaglandin-endoperoxide synthase 1 (Ptgs1), transcript variant X1, mRNA | 887 | 49.6% | 270.731 | 4.32e-67 | 72.5% |
| 298 | XM_063889924 | PREDICTED: Eleginops maclovinus prostaglandin G/H synthase 1-like (LOC134868647), transcript variant X1, mRNA | 1639 | 91.7% | 484.943 | 1.42e-131 | 72.3% |
| 299 | XM_061262022 | PREDICTED: Conger conger prostaglandin G/H synthase 1-like (LOC133141450), mRNA | 1634 | 91.4% | 475.709 | 8.52e-129 | 72.3% |
| 300 | XM_044778843 | PREDICTED: Equus asinus prostaglandin-endoperoxide synthase 1 (PTGS1), transcript variant X3, mRNA | 1354 | 75.7% | 385.223 | 1.48e-101 | 72.3% |
| 301 | XM_014858316 | PREDICTED: Equus asinus prostaglandin-endoperoxide synthase 1 (PTGS1), transcript variant X1, mRNA | 1354 | 75.7% | 385.223 | 1.48e-101 | 72.3% |
| 302 | XM_046642586 | PREDICTED: Equus quagga prostaglandin-endoperoxide synthase 1 (PTGS1), mRNA | 1354 | 75.7% | 379.683 | 6.87e-100 | 72.2% |
| 303 | XM_008572036 | PREDICTED: Galeopterus variegatus prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) (PTGS1), mRNA | 1381 | 77.2% | 351.984 | 1.50e-91 | 71.7% |
| 304 | XM_028402930 | PREDICTED: Parambassis ranga prostaglandin-endoperoxide synthase 2 (ptgs2), mRNA | 933 | 52.2% | 235.645 | 1.57e-56 | 71.6% |
| 305 | XM_033137700 | PREDICTED: Lacerta agilis prostaglandin-endoperoxide synthase 1 (PTGS1), mRNA | 1652 | 92.4% | 403.69 | 4.08e-107 | 71.5% |
| 306 | XM_013121983 | PREDICTED: Mesocricetus auratus prostaglandin-endoperoxide synthase 1 (Ptgs1), mRNA | 1355 | 75.8% | 331.671 | 1.95e-85 | 71.4% |
| 307 | XM_051185325 | PREDICTED: Phodopus roborovskii prostaglandin-endoperoxide synthase 1 (Ptgs1), mRNA | 1355 | 75.8% | 298.431 | 1.98e-75 | 71.0% |
| 308 | NM_001172396 | Oryzias latipes prostaglandin-endoperoxide synthase 2b (ptgs2b), mRNA | 933 | 52.2% | 174.705 | 3.48e-38 | 70.7% |
Selected alignment ⓘ
Selected taxonomy ⓘ
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
Analyst evaluation
Taxa of interest (TOI) analysis
Reasoning: Taxon of interest detected in candidate species.
This sections shows the taxa of interest (TOI) specified by the sample submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity | Database coverage | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Epinephelus | genus | Epinephelus | Epinephelus coioides | ON075825 | 1.0 |
Database coverage of Taxon of Interest EpinephelusThis Taxon of Interest has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Reference database:
Database coverage of Epinephelus
Flag 5.1A:
The reference data supports this taxon well
631 records
There are 631 sequence records in the reference database for Epinephelus that have been annotated with the given locus COX1. It is possible that more records exist for this taxon which were not correctly annotated with this locus.
Global occurrence records for Epinephelus.
Database coverage of species in genus Epinephelus
Flag 5.2B:
The reference data offers some support for species in this genus
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COX1 Database coverage of species in genus Epinephelus that occur in country of origin China
Flag 5.3A:
The reference data supports species in this genus well, when we evaluate only species that occur in the sample's country of origin
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COX1 |
||||||
| Epinephelus awoara | Did not match any candidate |
Database coverage of Taxon of Interest Epinephelus awoaraThis Taxon of Interest has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Reference database:
Database coverage of Epinephelus awoara
Flag 5.1A:
The reference data supports this taxon well
88 records
There are 88 sequence records in the reference database for Epinephelus awoara that have been annotated with the given locus COX1. It is possible that more records exist for this taxon which were not correctly annotated with this locus. 
Global occurrence records for Epinephelus awoara.
Database coverage of species in genus Epinephelus
Flag 5.2B:
The reference data offers some support for species in this genus
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COX1 Database coverage of species in genus Epinephelus that occur in country of origin China
Flag 5.3A:
The reference data supports species in this genus well, when we evaluate only species that occur in the sample's country of origin
/ (%) of species have sequence records in the reference database for:
Number of GenBank records at locus COX1 |
||||||||||
Publications supporting taxonomic association
This analysis evaluates how many independent publication events have contributed matching sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
Analyst evaluation
Candidates
Independent publication sources
Reasoning: Matching sequence records for this species have only 1-5 independent sources.
(Found 1 sources)
1 Independent Source
The matching reference sequences for this species have been annotated by 1 independent source(s). A source is considered independent if the author list or publication title is distinct.
Source 1
| Hit accession | Automated ⓘ | Authors | Title | Journal |
|---|---|---|---|---|
| ON075825 | False |
Zheng,Q. Guo,X. Wang,W. Huang,Y. Huang,X. Qin,Q. |
Direct Submission | Submitted (24-MAR-2022) College of Marine Sciences, South China Agricultural University, No.483 Wushan Road, Guangzhou, Guangdong 510642, China |
| ON075825 | False |
Zheng,Q. Guo,X. Wang,W. Huang,Y. Huang,X. Qin,Q. |
Direct Submission | Submitted (24-MAR-2022) College of Marine Sciences, South China Agricultural University, No.483 Wushan Road, Guangzhou, Guangdong 510642, China |
| ON075825 | False |
Zheng,Q. Guo,X. Wang,W. Huang,Y. Huang,X. Qin,Q. |
Direct Submission | Submitted (24-MAR-2022) College of Marine Sciences, South China Agricultural University, No.483 Wushan Road, Guangzhou, Guangdong 510642, China |
| ON075825 | False |
Zheng,Q. Guo,X. Wang,W. Huang,Y. Huang,X. Qin,Q. |
Direct Submission | Submitted (24-MAR-2022) College of Marine Sciences, South China Agricultural University, No.483 Wushan Road, Guangzhou, Guangdong 510642, China |
| ON075825 | False |
Zheng,Q. Guo,X. Wang,W. Huang,Y. Huang,X. Qin,Q. |
Direct Submission | Submitted (24-MAR-2022) College of Marine Sciences, South China Agricultural University, No.483 Wushan Road, Guangzhou, Guangdong 510642, China |
| Show Hide 3 more publications... | ||||
Independent publication sources
Reasoning: Matching sequence records for this species have only 1-5 independent sources.
(Found 1 sources)
1 Independent Source
The matching reference sequences for this species have been annotated by 1 independent source(s). A source is considered independent if the author list or publication title is distinct.
Source 1
| Hit accession | Automated ⓘ | Authors | Title | Journal |
|---|---|---|---|---|
| XM_033618714 | True | No publications for this record | ||
Independent publication sources
Reasoning: Matching sequence records for this species have only 1-5 independent sources.
(Found 1 sources)
1 Independent Source
The matching reference sequences for this species have been annotated by 1 independent source(s). A source is considered independent if the author list or publication title is distinct.
Source 1
| Hit accession | Automated ⓘ | Authors | Title | Journal |
|---|---|---|---|---|
| XM_050051969 | True | No publications for this record | ||
Intraspecies diversity
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species" clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
Analyst evaluation
Click + drag to pan
Scroll to zoom in/out
Click a label to view NCBI record
This phylogenetic tree shows the genetic relationship between the query sequence
(labelled QUERY)
and matching reference sequences (labelled species/accession).
The tree was computed with
FastME
using the Neighbor-Joining method. Multiple-sequence alignment of the candidate reference sequences was performed using
MAFFT.
The visualization is rendered with
Phylocanvas.GL
.
Taxonomy Check
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |